Write fasta file, which is ready to run in ClustalW for multiple sequence alignment.

write_fasta.r

# Clustal doesn't like when there are spaces in species names, so `write_fasta` fixes that in case you forget. 
write_fasta <- function (sequences, file.out) {
  outfile <- file(description = file.out, open = "w")
  write.oneseq <- function(sequence, name) {
    if(grepl("\\s", name)){name<-gsub("\\s", "_", name)} else{name<-name}
    writeLines(paste(">", name, sep = ""), outfile)
    writeLines(sequence[[1]], outfile)
  }
  sapply(seq_len(length(sequences)), function(x) write.oneseq(
    sequence=as.character(sequences[[x]]), name=names(sequences[x])))
  close(outfile)
}

# Note that they are all the same sequence
myseqs <- c("TCTTATTTACAATAGGAGGATTATCAGGAATTATATTATCAAATTCATCTATTGATATTATACTACACGATACTTATTACGTTATTGGACACTTTCATTATGTACTCTCAATA",
            "TCTTATTTACAATAGGAGGATTATCAGGAATTATATTATCAAATTCATCTATTGATATTATACTACACGATACTTATTACGTTATTGGACACTTTCATTATGTACTCTCAATA",
            "TCTTATTTACAATAGGAGGATTATCAGGAATTATATTATCAAATTCATCTATTGATATTATACTACACGATACTTATTACGTTATTGGACACTTTCATTATGTACTCTCAATA")
names(myseqs) <- c("Apis_mellifera","Homo sapiens","Helianthus annuus")

write_fasta(myseqs, "myseqs.fas")

now lives here in sacbox repo: https://github.com/SChamberlain/sacbox/blob/master/R/write_fasta.r