Skip to content

Instantly share code, notes, and snippets.

@sdwfrost
Created May 5, 2015 09:56
Show Gist options
  • Save sdwfrost/2efba8fdb7085a28048a to your computer and use it in GitHub Desktop.
Save sdwfrost/2efba8fdb7085a28048a to your computer and use it in GitHub Desktop.
Sequence file for use with hellobeagle.ipynb
>mars
CCGAG-AGCAGCAATGGAT-GAGGCATGGCG
>saturn
GCGCGCAGCTGCTGTAGATGGAGGCATGACG
>jupiter
GCGCGCAGCAGCTGTGGATGGAAGGATGACG
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment