Last active
January 25, 2018 14:24
-
-
Save shyouhei/9f3aea1b6845dd8baeda14e4f6cd02d1 to your computer and use it in GitHub Desktop.
We can make this file beautiful and searchable if this error is corrected: Illegal quoting in line 2.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| 2018-01-25 22:56:13 +0900 | |
| target 0: 2.6 (ruby 2.6.0dev (2018-01-25 trunk 62035) [x86_64-darwin15]) at "../trunk@svn/miniruby" | |
| target 1: 2.4 (ruby 2.4.4p228 (2018-01-15 revision 61854) [x86_64-darwin15]) at "../ruby_2_4@svn/miniruby" | |
| target 2: 2.5 (ruby 2.5.0p12 (2018-01-24 revision 62023) [x86_64-darwin15]) at "../ruby_2_5@svn/miniruby" | |
| target 3: mov (ruby 2.6.0dev (2018-01-25) [x86_64-darwin15]) at "./miniruby.move-only" | |
| target 4: ours (ruby 2.6.0dev (2018-01-25 per-insn-annot.. 62006) [x86_64-darwin15] | |
| last_commit=fixme PC tweak for frame-pushing instructions) at "./miniruby" | |
| measure target: real | |
| ----------------------------------------------------------- | |
| so_ackermann | |
| #!/usr/bin/ruby | |
| # -*- mode: ruby -*- | |
| # $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $ | |
| # http://www.bagley.org/~doug/shootout/ | |
| def ack(m, n) | |
| if m == 0 then | |
| n + 1 | |
| elsif n == 0 then | |
| ack(m - 1, 1) | |
| else | |
| ack(m - 1, ack(m, n - 1)) | |
| end | |
| end | |
| NUM = 9 | |
| ack(3, NUM) | |
| 2.6 0.4554562140001508 | |
| 2.6 0.5460585769997124 | |
| 2.6 0.48677734000011696 | |
| 2.4 0.5426385809987551 | |
| 2.4 0.5000252749996434 | |
| 2.4 0.5233149949999643 | |
| 2.5 0.5049834759993246 | |
| 2.5 0.4907812910005305 | |
| 2.5 0.4685020809993148 | |
| mov 0.5007250029993884 | |
| mov 0.5030296860004455 | |
| mov 0.5188449830002355 | |
| ours 0.4566567390011187 | |
| ours 0.48271287699935783 | |
| ours 0.4353388810013712 | |
| ----------------------------------------------------------- | |
| so_array | |
| #!/usr/bin/ruby | |
| # -*- mode: ruby -*- | |
| # $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $ | |
| # http://www.bagley.org/~doug/shootout/ | |
| # with help from Paul Brannan and Mark Hubbart | |
| n = 9000 # Integer(ARGV.shift || 1) | |
| x = Array.new(n) | |
| y = Array.new(n, 0) | |
| n.times{|bi| | |
| x[bi] = bi + 1 | |
| } | |
| (0 .. 999).each do |e| | |
| (n-1).step(0,-1) do |bi| | |
| y[bi] += x.at(bi) | |
| end | |
| end | |
| # puts "#{y.first} #{y.last}" | |
| 2.6 1.001565152000694 | |
| 2.6 0.9968090410002333 | |
| 2.6 0.9579997450000519 | |
| 2.4 0.9520652720002545 | |
| 2.4 0.9347633369998221 | |
| 2.4 0.9071830599987152 | |
| 2.5 0.9791266880001785 | |
| 2.5 0.9549793690002844 | |
| 2.5 0.9539940169997863 | |
| mov 0.7793143929993676 | |
| mov 0.8528579640005773 | |
| mov 0.7667878169995674 | |
| ours 0.8373816940002143 | |
| ours 0.8716633730000467 | |
| ours 0.8410910629991122 | |
| ----------------------------------------------------------- | |
| so_binary_trees | |
| # The Computer Language Shootout Benchmarks | |
| # http://shootout.alioth.debian.org | |
| # | |
| # contributed by Jesse Millikan | |
| # disable output | |
| alias puts_orig puts | |
| def puts str | |
| # disable puts | |
| end | |
| def item_check(tree) | |
| if tree[0] == nil | |
| tree[1] | |
| else | |
| tree[1] + item_check(tree[0]) - item_check(tree[2]) | |
| end | |
| end | |
| def bottom_up_tree(item, depth) | |
| if depth > 0 | |
| item_item = 2 * item | |
| depth -= 1 | |
| [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)] | |
| else | |
| [nil, item, nil] | |
| end | |
| end | |
| max_depth = 16 # ARGV[0].to_i | |
| min_depth = 4 | |
| max_depth = min_depth + 2 if min_depth + 2 > max_depth | |
| stretch_depth = max_depth + 1 | |
| stretch_tree = bottom_up_tree(0, stretch_depth) | |
| puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}" | |
| stretch_tree = nil | |
| long_lived_tree = bottom_up_tree(0, max_depth) | |
| min_depth.step(max_depth + 1, 2) do |depth| | |
| iterations = 2**(max_depth - depth + min_depth) | |
| check = 0 | |
| for i in 1..iterations | |
| temp_tree = bottom_up_tree(i, depth) | |
| check += item_check(temp_tree) | |
| temp_tree = bottom_up_tree(-i, depth) | |
| check += item_check(temp_tree) | |
| end | |
| puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}" | |
| end | |
| puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}" | |
| undef puts | |
| alias puts puts_orig | |
| 2.6 5.580577554999763 | |
| 2.6 5.672877137998512 | |
| 2.6 5.681266890000188 | |
| 2.4 5.6974034150007355 | |
| 2.4 5.571260650000113 | |
| 2.4 5.640231679999488 | |
| 2.5 5.69990062999932 | |
| 2.5 5.733895809999012 | |
| 2.5 5.803898205000223 | |
| mov 5.811514707000242 | |
| mov 5.8644480610000755 | |
| mov 5.676164667998819 | |
| ours 5.331443604000015 | |
| ours 5.276973361000273 | |
| ours 5.304218047998802 | |
| ----------------------------------------------------------- | |
| so_concatenate | |
| #!/usr/bin/ruby | |
| # -*- mode: ruby -*- | |
| # $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $ | |
| # http://www.bagley.org/~doug/shootout/ | |
| # based on code from Aristarkh A Zagorodnikov and Dat Nguyen | |
| STUFF = "hello\n" | |
| i = 0 | |
| while i<10 | |
| i += 1 | |
| hello = '' | |
| 4_000_000.times do |e| | |
| hello << STUFF | |
| end | |
| end | |
| # puts hello.length | |
| 2.6 4.162689265000154 | |
| 2.6 4.050541177999548 | |
| 2.6 3.940061029001299 | |
| 2.4 3.8832351839992043 | |
| 2.4 4.06592698500026 | |
| 2.4 4.063692245999846 | |
| 2.5 3.967408909998994 | |
| 2.5 4.124347431999922 | |
| 2.5 4.109010133999618 | |
| mov 3.357697522000308 | |
| mov 3.426567314998465 | |
| mov 3.360884959000032 | |
| ours 3.5874504879993765 | |
| ours 3.4942243530003907 | |
| ours 3.564860012000281 | |
| ----------------------------------------------------------- | |
| so_count_words | |
| #!/usr/bin/ruby | |
| # -*- mode: ruby -*- | |
| # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $ | |
| # http://www.bagley.org/~doug/shootout/ | |
| # with help from Paul Brannan | |
| input = open(File.join(File.dirname($0), 'wc.input'), 'rb') | |
| nl = nw = nc = 0 | |
| while true | |
| tmp = input.read(4096) or break | |
| data = tmp << (input.gets || "") | |
| nc += data.length | |
| nl += data.count("\n") | |
| ((data.strip! || data).tr!("\n", " ") || data).squeeze! | |
| nw += data.count(" ") + 1 | |
| end | |
| # STDERR.puts "#{nl} #{nw} #{nc}" | |
| 2.6 0.2116428770004859 | |
| 2.6 0.1751734769986797 | |
| 2.6 0.16015411599983054 | |
| 2.4 0.18809206900004938 | |
| 2.4 0.1868481969995628 | |
| 2.4 0.18051345399908314 | |
| 2.5 0.15815120999832288 | |
| 2.5 0.15577895199930936 | |
| 2.5 0.16851444699932472 | |
| mov 0.19810375300039595 | |
| mov 0.18774900899916247 | |
| mov 0.17638365699895076 | |
| ours 0.15821733499979018 | |
| ours 0.15316619599980186 | |
| ours 0.15631227900121303 | |
| ----------------------------------------------------------- | |
| so_exception | |
| #!/usr/bin/ruby | |
| # -*- mode: ruby -*- | |
| # $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $ | |
| # http://www.bagley.org/~doug/shootout/ | |
| $HI = 0 | |
| $LO = 0 | |
| NUM = 250000 # Integer(ARGV[0] || 1) | |
| class Lo_Exception < Exception | |
| def initialize(num) | |
| @value = num | |
| end | |
| end | |
| class Hi_Exception < Exception | |
| def initialize(num) | |
| @value = num | |
| end | |
| end | |
| def some_function(num) | |
| begin | |
| hi_function(num) | |
| rescue | |
| print "We shouldn't get here, exception is: #{$!.type}\n" | |
| end | |
| end | |
| def hi_function(num) | |
| begin | |
| lo_function(num) | |
| rescue Hi_Exception | |
| $HI = $HI + 1 | |
| end | |
| end | |
| def lo_function(num) | |
| begin | |
| blowup(num) | |
| rescue Lo_Exception | |
| $LO = $LO + 1 | |
| end | |
| end | |
| def blowup(num) | |
| if num % 2 == 0 | |
| raise Lo_Exception.new(num) | |
| else | |
| raise Hi_Exception.new(num) | |
| end | |
| end | |
| i = 1 | |
| max = NUM+1 | |
| while i < max | |
| i += 1 | |
| some_function(i+1) | |
| end | |
| 2.6 0.2500917070010473 | |
| 2.6 0.2577815829990868 | |
| 2.6 0.2467453930003103 | |
| 2.4 0.2741440910012898 | |
| 2.4 0.3024373070002184 | |
| 2.4 0.2643489359998057 | |
| 2.5 0.27839342600054806 | |
| 2.5 0.2732393279984535 | |
| 2.5 0.29030586299995775 | |
| mov 0.25994120500035933 | |
| mov 0.2585156980003376 | |
| mov 0.2854875550001452 | |
| ours 0.23863023100057035 | |
| ours 0.233121231000041 | |
| ours 0.23833293300049263 | |
| ----------------------------------------------------------- | |
| so_fannkuch | |
| # The Computer Language Shootout | |
| # http://shootout.alioth.debian.org/ | |
| # Contributed by Sokolov Yura | |
| # Modified by Ryan Williams | |
| def fannkuch(n) | |
| maxFlips, m, r, check = 0, n-1, n, 0 | |
| count = (1..n).to_a | |
| perm = (1..n).to_a | |
| while true | |
| if check < 30 | |
| puts "#{perm}" | |
| check += 1 | |
| end | |
| while r != 1 | |
| count[r-1] = r | |
| r -= 1 | |
| end | |
| if perm[0] != 1 and perm[m] != n | |
| perml = perm.clone #.dup | |
| flips = 0 | |
| while (k = perml.first ) != 1 | |
| perml = perml.slice!(0, k).reverse + perml | |
| flips += 1 | |
| end | |
| maxFlips = flips if flips > maxFlips | |
| end | |
| while true | |
| if r==n then return maxFlips end | |
| perm.insert r,perm.shift | |
| break if (count[r] -= 1) > 0 | |
| r += 1 | |
| end | |
| end | |
| end | |
| def puts *args | |
| end | |
| N = 9 # (ARGV[0] || 1).to_i | |
| puts "Pfannkuchen(#{N}) = #{fannkuch(N)}" | |
| 2.6 1.0336100099993928 | |
| 2.6 1.0444943120000971 | |
| 2.6 1.034648062000997 | |
| 2.4 1.043466446999446 | |
| 2.4 1.0758836380009598 | |
| 2.4 1.0880409520013927 | |
| 2.5 1.0696021799994924 | |
| 2.5 1.1295678669994231 | |
| 2.5 1.0254586539995216 | |
| mov 1.067924678000054 | |
| mov 1.0172085699996387 | |
| mov 1.0360942509996676 | |
| ours 1.019557445000828 | |
| ours 1.056072645000313 | |
| ours 0.9758349160001671 | |
| ----------------------------------------------------------- | |
| so_fasta | |
| # The Computer Language Shootout | |
| # http://shootout.alioth.debian.org/ | |
| # Contributed by Sokolov Yura | |
| $last = 42.0 | |
| def gen_random(max, im=139968, ia=3877, ic=29573) | |
| (max * ($last = ($last * ia + ic) % im)) / im | |
| end | |
| alu = | |
| "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+ | |
| "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+ | |
| "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+ | |
| "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+ | |
| "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+ | |
| "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+ | |
| "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" | |
| iub = [ | |
| ["a", 0.27], | |
| ["c", 0.12], | |
| ["g", 0.12], | |
| ["t", 0.27], | |
| ["B", 0.02], | |
| ["D", 0.02], | |
| ["H", 0.02], | |
| ["K", 0.02], | |
| ["M", 0.02], | |
| ["N", 0.02], | |
| ["R", 0.02], | |
| ["S", 0.02], | |
| ["V", 0.02], | |
| ["W", 0.02], | |
| ["Y", 0.02], | |
| ] | |
| homosapiens = [ | |
| ["a", 0.3029549426680], | |
| ["c", 0.1979883004921], | |
| ["g", 0.1975473066391], | |
| ["t", 0.3015094502008], | |
| ] | |
| def make_repeat_fasta(id, desc, src, n) | |
| puts ">#{id} #{desc}" | |
| v = nil | |
| width = 60 | |
| l = src.length | |
| s = src * ((n / l) + 1) | |
| s.slice!(n, l) | |
| puts(s.scan(/.{1,#{width}}/).join("\n")) | |
| end | |
| def make_random_fasta(id, desc, table, n) | |
| puts ">#{id} #{desc}" | |
| rand, v = nil,nil | |
| width = 60 | |
| chunk = 1 * width | |
| prob = 0.0 | |
| table.each{|v| v[1]= (prob += v[1])} | |
| for i in 1..(n/width) | |
| puts((1..width).collect{ | |
| rand = gen_random(1.0) | |
| table.find{|v| v[1]>rand}[0] | |
| }.join) | |
| end | |
| if n%width != 0 | |
| puts((1..(n%width)).collect{ | |
| rand = gen_random(1.0) | |
| table.find{|v| v[1]>rand}[0] | |
| }.join) | |
| end | |
| end | |
| n = (ARGV[0] or 250_000).to_i | |
| make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2) | |
| make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3) | |
| make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5) | |
| 2.6 1.5346465650000027 | |
| 2.6 1.5587319389996992 | |
| 2.6 1.5562305639996339 | |
| 2.4 1.4634280749996833 | |
| 2.4 1.5208723189989541 | |
| 2.4 1.5450861049994273 | |
| 2.5 1.5067925960011053 | |
| 2.5 1.5190188649994525 | |
| 2.5 1.5980066030006128 | |
| mov 1.470517698000549 | |
| mov 1.4239339609994204 | |
| mov 1.4360517959994468 | |
| ours 1.4852364859998488 | |
| ours 1.5562712290011405 | |
| ours 1.497141076000844 | |
| ----------------------------------------------------------- | |
| so_k_nucleotide | |
| # The Computer Language Shootout | |
| # http://shootout.alioth.debian.org | |
| # | |
| # contributed by jose fco. gonzalez | |
| # modified by Sokolov Yura | |
| seq = String.new | |
| def frecuency( seq,length ) | |
| n, table = seq.length - length + 1, Hash.new(0) | |
| f, i = nil, nil | |
| (0 ... length).each do |f| | |
| (f ... n).step(length) do |i| | |
| table[seq[i,length]] += 1 | |
| end | |
| end | |
| [n,table] | |
| end | |
| def sort_by_freq( seq,length ) | |
| n,table = frecuency( seq,length ) | |
| a, b, v = nil, nil, nil | |
| table.sort{|a,b| b[1] <=> a[1]}.each do |v| | |
| puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)] | |
| end | |
| puts | |
| end | |
| def find_seq( seq,s ) | |
| n,table = frecuency( seq,s.length ) | |
| puts "#{table[s].to_s}\t#{s.upcase}" | |
| end | |
| input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb') | |
| line = input.gets while line !~ /^>THREE/ | |
| line = input.gets | |
| while (line !~ /^>/) & line do | |
| seq << line.chomp | |
| line = input.gets | |
| end | |
| [1,2].each {|i| sort_by_freq( seq,i ) } | |
| %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) } | |
| 2.6 1.2793361570002162 | |
| 2.6 1.2651835870001378 | |
| 2.6 1.1648964539999724 | |
| 2.4 1.2761893210008566 | |
| 2.4 1.2424752150000131 | |
| 2.4 1.2707221489999938 | |
| 2.5 1.2316716850000375 | |
| 2.5 1.2456048450003436 | |
| 2.5 1.199178054001095 | |
| mov 1.1634166130006633 | |
| mov 1.0996732419989712 | |
| mov 1.146168231000047 | |
| ours 1.1135896050000156 | |
| ours 1.1313269679994846 | |
| ours 1.1500560799995583 | |
| ----------------------------------------------------------- | |
| so_lists | |
| #from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby | |
| NUM = 300 | |
| SIZE = 10000 | |
| def test_lists() | |
| # create a list of integers (Li1) from 1 to SIZE | |
| li1 = (1..SIZE).to_a | |
| # copy the list to li2 (not by individual items) | |
| li2 = li1.dup | |
| # remove each individual item from left side of li2 and | |
| # append to right side of li3 (preserving order) | |
| li3 = Array.new | |
| while (not li2.empty?) | |
| li3.push(li2.shift) | |
| end | |
| # li2 must now be empty | |
| # remove each individual item from right side of li3 and | |
| # append to right side of li2 (reversing list) | |
| while (not li3.empty?) | |
| li2.push(li3.pop) | |
| end | |
| # li3 must now be empty | |
| # reverse li1 in place | |
| li1.reverse! | |
| # check that first item is now SIZE | |
| if li1[0] != SIZE then | |
| p "not SIZE" | |
| 0 | |
| else | |
| # compare li1 and li2 for equality | |
| if li1 != li2 then | |
| return(0) | |
| else | |
| # return the length of the list | |
| li1.length | |
| end | |
| end | |
| end | |
| i = 0 | |
| while i<NUM | |
| i += 1 | |
| result = test_lists() | |
| end | |
| result | |
| 2.6 0.5218417550004233 | |
| 2.6 0.510902490999797 | |
| 2.6 0.47880745499969635 | |
| 2.4 0.4924291390016151 | |
| 2.4 0.5186816120003641 | |
| 2.4 0.48233753299973614 | |
| 2.5 0.44882155699997384 | |
| 2.5 0.45768725899870333 | |
| 2.5 0.4700806780001585 | |
| mov 0.506731552999554 | |
| mov 0.4655134580007143 | |
| mov 0.4916510860002745 | |
| ours 0.4514159390000714 | |
| ours 0.4717869590003829 | |
| ours 0.45853865900062374 | |
| ----------------------------------------------------------- | |
| so_mandelbrot | |
| # The Computer Language Benchmarks Game | |
| # http://shootout.alioth.debian.org/ | |
| # | |
| # contributed by Karl von Laudermann | |
| # modified by Jeremy Echols | |
| size = 600 # ARGV[0].to_i | |
| puts "P4\n#{size} #{size}" | |
| ITER = 49 # Iterations - 1 for easy for..in looping | |
| LIMIT_SQUARED = 4.0 # Presquared limit | |
| byte_acc = 0 | |
| bit_num = 0 | |
| count_size = size - 1 # Precomputed size for easy for..in looping | |
| # For..in loops are faster than .upto, .downto, .times, etc. | |
| for y in 0..count_size | |
| for x in 0..count_size | |
| zr = 0.0 | |
| zi = 0.0 | |
| cr = (2.0*x/size)-1.5 | |
| ci = (2.0*y/size)-1.0 | |
| escape = false | |
| # To make use of the for..in code, we use a dummy variable, | |
| # like one would in C | |
| for dummy in 0..ITER | |
| tr = zr*zr - zi*zi + cr | |
| ti = 2*zr*zi + ci | |
| zr, zi = tr, ti | |
| if (zr*zr+zi*zi) > LIMIT_SQUARED | |
| escape = true | |
| break | |
| end | |
| end | |
| byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1) | |
| bit_num += 1 | |
| # Code is very similar for these cases, but using separate blocks | |
| # ensures we skip the shifting when it's unnecessary, which is most cases. | |
| if (bit_num == 8) | |
| print byte_acc.chr | |
| byte_acc = 0 | |
| bit_num = 0 | |
| elsif (x == count_size) | |
| byte_acc <<= (8 - bit_num) | |
| print byte_acc.chr | |
| byte_acc = 0 | |
| bit_num = 0 | |
| end | |
| end | |
| end | |
| 2.6 2.256111303999205 | |
| 2.6 2.2605629179997777 | |
| 2.6 2.241643777999343 | |
| 2.4 2.3938522539992846 | |
| 2.4 2.4874032780007838 | |
| 2.4 2.516099497999676 | |
| 2.5 2.473859124998853 | |
| 2.5 2.4914793590014597 | |
| 2.5 2.3492270719998487 | |
| mov 2.1200521369992202 | |
| mov 2.0968204119999427 | |
| mov 2.0987915380010236 | |
| ours 2.266777340999397 | |
| ours 2.2108405149992905 | |
| ours 2.2757371539992164 | |
| ----------------------------------------------------------- | |
| so_matrix | |
| #!/usr/bin/ruby | |
| # -*- mode: ruby -*- | |
| # $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $ | |
| # http://www.bagley.org/~doug/shootout/ | |
| n = 60 #Integer(ARGV.shift || 1) | |
| size = 40 | |
| def mkmatrix(rows, cols) | |
| count = 1 | |
| mx = Array.new(rows) | |
| (0 .. (rows - 1)).each do |bi| | |
| row = Array.new(cols, 0) | |
| (0 .. (cols - 1)).each do |j| | |
| row[j] = count | |
| count += 1 | |
| end | |
| mx[bi] = row | |
| end | |
| mx | |
| end | |
| def mmult(rows, cols, m1, m2) | |
| m3 = Array.new(rows) | |
| (0 .. (rows - 1)).each do |bi| | |
| row = Array.new(cols, 0) | |
| (0 .. (cols - 1)).each do |j| | |
| val = 0 | |
| (0 .. (cols - 1)).each do |k| | |
| val += m1.at(bi).at(k) * m2.at(k).at(j) | |
| end | |
| row[j] = val | |
| end | |
| m3[bi] = row | |
| end | |
| m3 | |
| end | |
| m1 = mkmatrix(size, size) | |
| m2 = mkmatrix(size, size) | |
| mm = Array.new | |
| n.times do | |
| mm = mmult(size, size, m1, m2) | |
| end | |
| # puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}" | |
| 2.6 0.5646408560005511 | |
| 2.6 0.5596649750004872 | |
| 2.6 0.5343214719996467 | |
| 2.4 0.6103218059997744 | |
| 2.4 0.5513107269998727 | |
| 2.4 0.613436568999532 | |
| 2.5 0.5668281639991619 | |
| 2.5 0.5668770060001407 | |
| 2.5 0.5371557170001324 | |
| mov 0.4638839500003087 | |
| mov 0.5026085760000569 | |
| mov 0.5268650039997738 | |
| ours 0.5241673550008272 | |
| ours 0.4785625139993499 | |
| ours 0.5010744080009317 | |
| ----------------------------------------------------------- | |
| so_meteor_contest | |
| #!/usr/bin/env ruby | |
| # | |
| # The Computer Language Shootout | |
| # http://shootout.alioth.debian.org | |
| # contributed by Kevin Barnes (Ruby novice) | |
| # PROGRAM: the main body is at the bottom. | |
| # 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ | |
| # 2) see how I represent a board as a bitmask by reading the blank_board comments | |
| # 3) read as your mental paths take you | |
| def print *args | |
| end | |
| # class to represent all information about a particular rotation of a particular piece | |
| class Rotation | |
| # an array (by location) containing a bit mask for how the piece maps at the given location. | |
| # if the rotation is invalid at that location the mask will contain false | |
| attr_reader :start_masks | |
| # maps a direction to a relative location. these differ depending on whether it is an even or | |
| # odd row being mapped from | |
| @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 } | |
| @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 } | |
| def initialize( directions ) | |
| @even_offsets, @odd_offsets = normalize_offsets( get_values( directions )) | |
| @even_mask = mask_for_offsets( @even_offsets) | |
| @odd_mask = mask_for_offsets( @odd_offsets) | |
| @start_masks = Array.new(60) | |
| # create the rotational masks by placing the base mask at the location and seeing if | |
| # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these | |
| # is true the piece cannot be placed | |
| 0.upto(59) do | offset | | |
| mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset) | |
| if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then | |
| imask = compute_required( mask, offset) | |
| @start_masks[offset] = [ mask, imask, imask | mask ] | |
| else | |
| @start_masks[offset] = false | |
| end | |
| end | |
| end | |
| def compute_required( mask, offset ) | |
| board = blank_board | |
| 0.upto(offset) { | i | board |= 1 << i } | |
| board |= mask | |
| return 0 if (!prunable(board | mask, offset)) | |
| board = flood_fill(board,58) | |
| count = 0 | |
| imask = 0 | |
| 0.upto(59) do | i | | |
| if (board[i] == 0) then | |
| imask |= (1 << i) | |
| count += 1 | |
| end | |
| end | |
| (count > 0 && count < 5) ? imask : 0 | |
| end | |
| def flood_fill( board, location) | |
| return board if (board[location] == 1) | |
| board |= 1 << location | |
| row, col = location.divmod(6) | |
| board = flood_fill( board, location - 1) if (col > 0) | |
| board = flood_fill( board, location + 1) if (col < 4) | |
| if (row % 2 == 0) then | |
| board = flood_fill( board, location - 7) if (col > 0 && row > 0) | |
| board = flood_fill( board, location - 6) if (row > 0) | |
| board = flood_fill( board, location + 6) if (row < 9) | |
| board = flood_fill( board, location + 5) if (col > 0 && row < 9) | |
| else | |
| board = flood_fill( board, location - 5) if (col < 4 && row > 0) | |
| board = flood_fill( board, location - 6) if (row > 0) | |
| board = flood_fill( board, location + 6) if (row < 9) | |
| board = flood_fill( board, location + 7) if (col < 4 && row < 9) | |
| end | |
| board | |
| end | |
| # given a location, produces a list of relative locations covered by the piece at this rotation | |
| def offsets( location) | |
| if is_even( location) then | |
| @even_offsets.collect { | value | value + location } | |
| else | |
| @odd_offsets.collect { | value | value + location } | |
| end | |
| end | |
| # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows) | |
| # this is hard to explain. imagine we have this partial board: | |
| # 0 0 0 0 0 x [positions 0-5] | |
| # 0 0 1 1 0 x [positions 6-11] | |
| # 0 0 1 0 0 x [positions 12-17] | |
| # 0 1 0 0 0 x [positions 18-23] | |
| # 0 1 0 0 0 x [positions 24-29] | |
| # 0 0 0 0 0 x [positions 30-35] | |
| # ... | |
| # The top-left of the piece is at position 8, the | |
| # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that | |
| # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained | |
| # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row: | |
| # 0 0 0 1 1 x [positions 0-5] | |
| # 0 0 1 0 0 x [positions 6-11] | |
| # 0 0 1 0 0 x [positions 12-17] | |
| # 0 1 0 0 0 x [positions 18-23] | |
| # 0 0 0 0 0 x [positions 24-29] | |
| # 0 0 0 0 0 x [positions 30-35] | |
| # ... | |
| # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the | |
| # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what | |
| # this function would return | |
| def normalize_offsets( values) | |
| min = values.min | |
| even_min = is_even(min) | |
| other_min = even_min ? min + 6 : min + 7 | |
| other_values = values.collect do | value | | |
| if is_even(value) then | |
| value + 6 - other_min | |
| else | |
| value + 7 - other_min | |
| end | |
| end | |
| values.collect! { | value | value - min } | |
| if even_min then | |
| [values, other_values] | |
| else | |
| [other_values, values] | |
| end | |
| end | |
| # produce a bitmask representation of an array of offset locations | |
| def mask_for_offsets( offsets ) | |
| mask = 0 | |
| offsets.each { | value | mask = mask + ( 1 << value ) } | |
| mask | |
| end | |
| # finds a "safe" position that a position as described by a list of directions can be placed | |
| # without falling off any edge of the board. the values returned a location to place the first piece | |
| # at so it will fit after making the described moves | |
| def start_adjust( directions ) | |
| south = east = 0; | |
| directions.each do | direction | | |
| east += 1 if ( direction == :sw || direction == :nw || direction == :west ) | |
| south += 1 if ( direction == :nw || direction == :ne ) | |
| end | |
| south * 6 + east | |
| end | |
| # given a set of directions places the piece (as defined by a set of directions) on the board at | |
| # a location that will not take it off the edge | |
| def get_values( directions ) | |
| start = start_adjust(directions) | |
| values = [ start ] | |
| directions.each do | direction | | |
| if (start % 12 >= 6) then | |
| start += @@rotation_odd_adder[direction] | |
| else | |
| start += @@rotation_even_adder[direction] | |
| end | |
| values += [ start ] | |
| end | |
| # some moves take you back to an existing location, we'll strip duplicates | |
| values.uniq | |
| end | |
| end | |
| # describes a piece and caches information about its rotations to as to be efficient for iteration | |
| # ATTRIBUTES: | |
| # rotations -- all the rotations of the piece | |
| # type -- a numeic "name" of the piece | |
| # masks -- an array by location of all legal rotational masks (a n inner array) for that location | |
| # placed -- the mask that this piece was last placed at (not a location, but the actual mask used) | |
| class Piece | |
| attr_reader :rotations, :type, :masks | |
| attr_accessor :placed | |
| # transform hashes that change one direction into another when you either flip or rotate a set of directions | |
| @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne } | |
| @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw } | |
| def initialize( directions, type ) | |
| @type = type | |
| @rotations = Array.new(); | |
| @map = {} | |
| generate_rotations( directions ) | |
| directions.collect! { | value | @@flip_converter[value] } | |
| generate_rotations( directions ) | |
| # creates the masks AND a map that returns [location, rotation] for any given mask | |
| # this is used when a board is found and we want to draw it, otherwise the map is unused | |
| @masks = Array.new(); | |
| 0.upto(59) do | i | | |
| even = true | |
| @masks[i] = @rotations.collect do | rotation | | |
| mask = rotation.start_masks[i] | |
| @map[mask[0]] = [ i, rotation ] if (mask) | |
| mask || nil | |
| end | |
| @masks[i].compact! | |
| end | |
| end | |
| # rotates a set of directions through all six angles and adds a Rotation to the list for each one | |
| def generate_rotations( directions ) | |
| 6.times do | |
| rotations.push( Rotation.new(directions)) | |
| directions.collect! { | value | @@rotate_converter[value] } | |
| end | |
| end | |
| # given a board string, adds this piece to the board at whatever location/rotation | |
| # important: the outbound board string is 5 wide, the normal location notation is six wide (padded) | |
| def fill_string( board_string) | |
| location, rotation = @map[@placed] | |
| rotation.offsets(location).each do | offset | | |
| row, col = offset.divmod(6) | |
| board_string[ row*5 + col, 1 ] = @type.to_s | |
| end | |
| end | |
| end | |
| # a blank bit board having this form: | |
| # | |
| # 0 0 0 0 0 1 | |
| # 0 0 0 0 0 1 | |
| # 0 0 0 0 0 1 | |
| # 0 0 0 0 0 1 | |
| # 0 0 0 0 0 1 | |
| # 0 0 0 0 0 1 | |
| # 0 0 0 0 0 1 | |
| # 0 0 0 0 0 1 | |
| # 0 0 0 0 0 1 | |
| # 0 0 0 0 0 1 | |
| # 1 1 1 1 1 1 | |
| # | |
| # where left lest significant bit is the top left and the most significant is the lower right | |
| # the actual board only consists of the 0 places, the 1 places are blockers to keep things from running | |
| # off the edges or bottom | |
| def blank_board | |
| 0b111111100000100000100000100000100000100000100000100000100000100000 | |
| end | |
| def full_board | |
| 0b111111111111111111111111111111111111111111111111111111111111111111 | |
| end | |
| # determines if a location (bit position) is in an even row | |
| def is_even( location) | |
| (location % 12) < 6 | |
| end | |
| # support function that create three utility maps: | |
| # $converter -- for each row an array that maps a five bit row (via array mapping) | |
| # to the a five bit representation of the bits below it | |
| # $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row | |
| # @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays | |
| # a region array has three values the first is a mask of bits in the region, | |
| # the second is the count of those bits and the third is identical to the first | |
| # examples: | |
| # 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001] | |
| # 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001] | |
| # 0b10001 => [ 0b01110, 3, 0b01110 ] | |
| def create_collector_support | |
| odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000] | |
| even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000] | |
| all_odds = Array.new(0b100000) | |
| all_evens = Array.new(0b100000) | |
| bit_counts = Array.new(0b100000) | |
| new_regions = Array.new(0b100000) | |
| 0.upto(0b11111) do | i | | |
| bit_count = odd = even = 0 | |
| 0.upto(4) do | bit | | |
| if (i[bit] == 1) then | |
| bit_count += 1 | |
| odd |= odd_map[bit] | |
| even |= even_map[bit] | |
| end | |
| end | |
| all_odds[i] = odd | |
| all_evens[i] = even | |
| bit_counts[i] = bit_count | |
| new_regions[i] = create_regions( i) | |
| end | |
| $converter = [] | |
| 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) } | |
| $bit_counts = bit_counts | |
| $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } } | |
| end | |
| # determines if a board is punable, meaning that there is no possibility that it | |
| # can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces | |
| # that are not a multiple of five. The following board is an example of a prunable board: | |
| # 0 0 1 0 0 | |
| # 0 1 0 0 0 | |
| # 1 1 0 0 0 | |
| # 0 1 0 0 0 | |
| # 0 0 0 0 0 | |
| # ... | |
| # | |
| # This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it | |
| # parameters: | |
| # board -- an initial bit board (6 bit padded rows, see blank_board for format) | |
| # location -- starting location, everything above and to the left is already full | |
| # slotting -- set to true only when testing initial pieces, when filling normally | |
| # additional assumptions are possible | |
| # | |
| # Algorithm: | |
| # The algorithm starts at the top row (as determined by location) and iterates a row at a time | |
| # maintainng counts of active open areas (kept in the collector array) each collector contains | |
| # three values at the start of an iteration: | |
| # 0: mask of bits that would be adjacent to the collector in this row | |
| # 1: the number of bits collected so far | |
| # 2: a scratch space starting as zero, but used during the computation to represent | |
| # the empty bits in the new row that are adjacent (position 0) | |
| # The exact procedure is described in-code | |
| def prunable( board, location, slotting = false) | |
| collectors = [] | |
| # loop across the rows | |
| (location / 6).to_i.upto(9) do | row_on | | |
| # obtain a set of regions representing the bits of the current row. | |
| regions = $regions[(board >> (row_on * 6)) & 0b11111] | |
| converter = $converter[row_on] | |
| # track the number of collectors at the start of the cycle so that | |
| # we don't compute against newly created collectors, only existing collectors | |
| initial_collector_count = collectors.length | |
| # loop against the regions. For each region of the row | |
| # we will see if it connects to one or more existing collectors. | |
| # if it connects to 1 collector, the bits from the region are added to the | |
| # bits of the collector and the mask is placed in collector[2] | |
| # If the region overlaps more than one collector then all the collectors | |
| # it overlaps with are merged into the first one (the others are set to nil in the array) | |
| # if NO collectors are found then the region is copied as a new collector | |
| regions.each do | region | | |
| collector_found = nil | |
| region_mask = region[2] | |
| initial_collector_count.times do | collector_num | | |
| collector = collectors[collector_num] | |
| if (collector) then | |
| collector_mask = collector[0] | |
| if (collector_mask & region_mask != 0) then | |
| if (collector_found) then | |
| collector_found[0] |= collector_mask | |
| collector_found[1] += collector[1] | |
| collector_found[2] |= collector[2] | |
| collectors[collector_num] = nil | |
| else | |
| collector_found = collector | |
| collector[1] += region[1] | |
| collector[2] |= region_mask | |
| end | |
| end | |
| end | |
| end | |
| if (collector_found == nil) then | |
| collectors.push(Array.new(region)) | |
| end | |
| end | |
| # check the existing collectors, if any collector overlapped no bits in the region its [2] value will | |
| # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since | |
| # the board is prunable. if it is a multiple of five it is removed. | |
| # Collector that are still active have a new adjacent value [0] set based n the matched bits | |
| # and have [2] cleared out for the next cycle. | |
| collectors.length.times do | collector_num | | |
| collector = collectors[collector_num] | |
| if (collector) then | |
| if (collector[2] == 0) then | |
| return true if (collector[1] % 5 != 0) | |
| collectors[collector_num] = nil | |
| else | |
| # if a collector matches all bits in the row then we can return unprunable early for the | |
| # following reasons: | |
| # 1) there can be no more unavailable bits bince we fill from the top left downward | |
| # 2) all previous regions have been closed or joined so only this region can fail | |
| # 3) this region must be good since there can never be only 1 region that is nuot | |
| # a multiple of five | |
| # this rule only applies when filling normally, so we ignore the rule if we are "slotting" | |
| # in pieces to see what configurations work for them (the only other time this algorithm is used). | |
| return false if (collector[2] == 0b11111 && !slotting) | |
| collector[0] = converter[collector[2]] | |
| collector[2] = 0 | |
| end | |
| end | |
| end | |
| # get rid of all the empty converters for the next round | |
| collectors.compact! | |
| end | |
| return false if (collectors.length <= 1) # 1 collector or less and the region is fine | |
| collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size | |
| end | |
| # creates a region given a row mask. see prunable for what a "region" is | |
| def create_regions( value ) | |
| regions = [] | |
| cur_region = 0 | |
| 5.times do | bit | | |
| if (value[bit] == 0) then | |
| cur_region |= 1 << bit | |
| else | |
| if (cur_region != 0 ) then | |
| regions.push( cur_region) | |
| cur_region = 0; | |
| end | |
| end | |
| end | |
| regions.push(cur_region) if (cur_region != 0) | |
| regions | |
| end | |
| # find up to the counted number of solutions (or all solutions) and prints the final result | |
| def find_all | |
| find_top( 1) | |
| find_top( 0) | |
| print_results | |
| end | |
| # show the board | |
| def print_results | |
| print "#{@boards_found} solutions found\n\n" | |
| print_full_board( @min_board) | |
| print "\n" | |
| print_full_board( @max_board) | |
| print "\n" | |
| end | |
| # finds solutions. This special version of the main function is only used for the top level | |
| # the reason for it is basically to force a particular ordering on how the rotations are tested for | |
| # the first piece. It is called twice, first looking for placements of the odd rotations and then | |
| # looking for placements of the even locations. | |
| # | |
| # WHY? | |
| # Since any found solution has an inverse we want to maximize finding solutions that are not already found | |
| # as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away | |
| # (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier | |
| # in the cycle. We still need to keep checking all the permutations, but our probability of finding one will | |
| # diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces | |
| # this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the | |
| # maximum number | |
| def find_top( rotation_skip) | |
| board = blank_board | |
| (@pieces.length-1).times do | |
| piece = @pieces.shift | |
| piece.masks[0].each do | mask, imask, cmask | | |
| if ((rotation_skip += 1) % 2 == 0) then | |
| piece.placed = mask | |
| find( 1, 1, board | mask) | |
| end | |
| end | |
| @pieces.push(piece) | |
| end | |
| piece = @pieces.shift | |
| @pieces.push(piece) | |
| end | |
| # the normail find routine, iterates through the available pieces, checks all rotations at the current location | |
| # and adds any boards found. depth is achieved via recursion. the overall approach is described | |
| # here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ | |
| # parameters: | |
| # start_location -- where to start looking for place for the next piece at | |
| # placed -- number of pieces placed | |
| # board -- current state of the board | |
| # | |
| # see in-code comments | |
| def find( start_location, placed, board) | |
| # find the next location to place a piece by looking for an empty bit | |
| while board[start_location] == 1 | |
| start_location += 1 | |
| end | |
| @pieces.length.times do | |
| piece = @pieces.shift | |
| piece.masks[start_location].each do | mask, imask, cmask | | |
| if ( board & cmask == imask) then | |
| piece.placed = mask | |
| if (placed == 9) then | |
| add_board | |
| else | |
| find( start_location + 1, placed + 1, board | mask) | |
| end | |
| end | |
| end | |
| @pieces.push(piece) | |
| end | |
| end | |
| # print the board | |
| def print_full_board( board_string) | |
| 10.times do | row | | |
| print " " if (row % 2 == 1) | |
| 5.times do | col | | |
| print "#{board_string[row*5 + col,1]} " | |
| end | |
| print "\n" | |
| end | |
| end | |
| # when a board is found we "draw it" into a string and then flip that string, adding both to | |
| # the list (hash) of solutions if they are unique. | |
| def add_board | |
| board_string = "99999999999999999999999999999999999999999999999999" | |
| @all_pieces.each { | piece | piece.fill_string( board_string ) } | |
| save( board_string) | |
| save( board_string.reverse) | |
| end | |
| # adds a board string to the list (if new) and updates the current best/worst board | |
| def save( board_string) | |
| if (@all_boards[board_string] == nil) then | |
| @min_board = board_string if (board_string < @min_board) | |
| @max_board = board_string if (board_string > @max_board) | |
| @all_boards.store(board_string,true) | |
| @boards_found += 1 | |
| # the exit motif is a time saver. Ideally the function should return, but those tests | |
| # take noticeable time (performance). | |
| if (@boards_found == @stop_count) then | |
| print_results | |
| exit(0) | |
| end | |
| end | |
| end | |
| ## | |
| ## MAIN BODY :) | |
| ## | |
| create_collector_support | |
| @pieces = [ | |
| Piece.new( [ :nw, :ne, :east, :east ], 2), | |
| Piece.new( [ :ne, :se, :east, :ne ], 7), | |
| Piece.new( [ :ne, :east, :ne, :nw ], 1), | |
| Piece.new( [ :east, :sw, :sw, :se ], 6), | |
| Piece.new( [ :east, :ne, :se, :ne ], 5), | |
| Piece.new( [ :east, :east, :east, :se ], 0), | |
| Piece.new( [ :ne, :nw, :se, :east, :se ], 4), | |
| Piece.new( [ :se, :se, :se, :west ], 9), | |
| Piece.new( [ :se, :se, :east, :se ], 8), | |
| Piece.new( [ :east, :east, :sw, :se ], 3) | |
| ]; | |
| @all_pieces = Array.new( @pieces) | |
| @min_board = "99999999999999999999999999999999999999999999999999" | |
| @max_board = "00000000000000000000000000000000000000000000000000" | |
| @stop_count = ARGV[0].to_i || 2089 | |
| @all_boards = {} | |
| @boards_found = 0 | |
| find_all ######## DO IT!!! | |
| 2.6 3.3938102409993007 | |
| 2.6 3.2230731029994786 | |
| 2.6 3.3083832079992135 | |
| 2.4 3.333183630000349 | |
| 2.4 3.1936890039996797 | |
| 2.4 3.352127272999496 | |
| 2.5 3.157131161000507 | |
| 2.5 3.1907435260000057 | |
| 2.5 3.1984603669989156 | |
| mov 2.930067057999622 | |
| mov 3.004820023999855 | |
| mov 3.0456303139999363 | |
| ours 3.0097075300000142 | |
| ours 3.029121400999429 | |
| ours 2.9827036269998644 | |
| ----------------------------------------------------------- | |
| so_nbody | |
| # The Computer Language Shootout | |
| # http://shootout.alioth.debian.org | |
| # | |
| # Optimized for Ruby by Jesse Millikan | |
| # From version ported by Michael Neumann from the C gcc version, | |
| # which was written by Christoph Bauer. | |
| SOLAR_MASS = 4 * Math::PI**2 | |
| DAYS_PER_YEAR = 365.24 | |
| def _puts *args | |
| end | |
| class Planet | |
| attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass | |
| def initialize(x, y, z, vx, vy, vz, mass) | |
| @x, @y, @z = x, y, z | |
| @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR | |
| @mass = mass * SOLAR_MASS | |
| end | |
| def move_from_i(bodies, nbodies, dt, i) | |
| while i < nbodies | |
| b2 = bodies[i] | |
| dx = @x - b2.x | |
| dy = @y - b2.y | |
| dz = @z - b2.z | |
| distance = Math.sqrt(dx * dx + dy * dy + dz * dz) | |
| mag = dt / (distance * distance * distance) | |
| b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag | |
| @vx -= dx * b2_mass_mag | |
| @vy -= dy * b2_mass_mag | |
| @vz -= dz * b2_mass_mag | |
| b2.vx += dx * b_mass_mag | |
| b2.vy += dy * b_mass_mag | |
| b2.vz += dz * b_mass_mag | |
| i += 1 | |
| end | |
| @x += dt * @vx | |
| @y += dt * @vy | |
| @z += dt * @vz | |
| end | |
| end | |
| def energy(bodies) | |
| e = 0.0 | |
| nbodies = bodies.size | |
| for i in 0 ... nbodies | |
| b = bodies[i] | |
| e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz) | |
| for j in (i + 1) ... nbodies | |
| b2 = bodies[j] | |
| dx = b.x - b2.x | |
| dy = b.y - b2.y | |
| dz = b.z - b2.z | |
| distance = Math.sqrt(dx * dx + dy * dy + dz * dz) | |
| e -= (b.mass * b2.mass) / distance | |
| end | |
| end | |
| e | |
| end | |
| def offset_momentum(bodies) | |
| px, py, pz = 0.0, 0.0, 0.0 | |
| for b in bodies | |
| m = b.mass | |
| px += b.vx * m | |
| py += b.vy * m | |
| pz += b.vz * m | |
| end | |
| b = bodies[0] | |
| b.vx = - px / SOLAR_MASS | |
| b.vy = - py / SOLAR_MASS | |
| b.vz = - pz / SOLAR_MASS | |
| end | |
| BODIES = [ | |
| # sun | |
| Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0), | |
| # jupiter | |
| Planet.new( | |
| 4.84143144246472090e+00, | |
| -1.16032004402742839e+00, | |
| -1.03622044471123109e-01, | |
| 1.66007664274403694e-03, | |
| 7.69901118419740425e-03, | |
| -6.90460016972063023e-05, | |
| 9.54791938424326609e-04), | |
| # saturn | |
| Planet.new( | |
| 8.34336671824457987e+00, | |
| 4.12479856412430479e+00, | |
| -4.03523417114321381e-01, | |
| -2.76742510726862411e-03, | |
| 4.99852801234917238e-03, | |
| 2.30417297573763929e-05, | |
| 2.85885980666130812e-04), | |
| # uranus | |
| Planet.new( | |
| 1.28943695621391310e+01, | |
| -1.51111514016986312e+01, | |
| -2.23307578892655734e-01, | |
| 2.96460137564761618e-03, | |
| 2.37847173959480950e-03, | |
| -2.96589568540237556e-05, | |
| 4.36624404335156298e-05), | |
| # neptune | |
| Planet.new( | |
| 1.53796971148509165e+01, | |
| -2.59193146099879641e+01, | |
| 1.79258772950371181e-01, | |
| 2.68067772490389322e-03, | |
| 1.62824170038242295e-03, | |
| -9.51592254519715870e-05, | |
| 5.15138902046611451e-05) | |
| ] | |
| init = 200_000 # ARGV[0] | |
| n = Integer(init) | |
| offset_momentum(BODIES) | |
| puts "%.9f" % energy(BODIES) | |
| nbodies = BODIES.size | |
| dt = 0.01 | |
| n.times do | |
| i = 0 | |
| while i < nbodies | |
| b = BODIES[i] | |
| b.move_from_i(BODIES, nbodies, dt, i + 1) | |
| i += 1 | |
| end | |
| end | |
| puts "%.9f" % energy(BODIES) | |
| 2.6 1.2550447880003048 | |
| 2.6 1.2584950679993199 | |
| 2.6 1.2902751980000176 | |
| 2.4 1.3688920330005203 | |
| 2.4 1.3770301200001995 | |
| 2.4 1.408765128999221 | |
| 2.5 1.3036340500002552 | |
| 2.5 1.3396144020007341 | |
| 2.5 1.2664047769994795 | |
| mov 1.188340609000079 | |
| mov 1.2322647380005947 | |
| mov 1.2222536250010307 | |
| ours 1.2926347680004255 | |
| ours 1.3014565510002285 | |
| ours 1.315888162000192 | |
| ----------------------------------------------------------- | |
| so_nested_loop | |
| #!/usr/bin/ruby | |
| # -*- mode: ruby -*- | |
| # $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $ | |
| # http://www.bagley.org/~doug/shootout/ | |
| # from Avi Bryant | |
| n = 16 # Integer(ARGV.shift || 1) | |
| x = 0 | |
| n.times do | |
| n.times do | |
| n.times do | |
| n.times do | |
| n.times do | |
| n.times do | |
| x += 1 | |
| end | |
| end | |
| end | |
| end | |
| end | |
| end | |
| # puts x | |
| 2.6 1.1500995039987174 | |
| 2.6 1.188764454000193 | |
| 2.6 1.149731467001402 | |
| 2.4 1.1660717530012334 | |
| 2.4 1.1208360170003289 | |
| 2.4 1.1860202200005006 | |
| 2.5 1.1673170880003454 | |
| 2.5 1.1572580709998874 | |
| 2.5 1.1291040689993679 | |
| mov 0.8745094159985456 | |
| mov 0.9048835060002602 | |
| mov 0.9134807700011152 | |
| ours 1.0407441609986563 | |
| ours 0.9862627140009863 | |
| ours 1.0047832319996814 | |
| ----------------------------------------------------------- | |
| so_nsieve | |
| # The Computer Language Shootout | |
| # http://shootout.alioth.debian.org/ | |
| # | |
| # contributed by Glenn Parker, March 2005 | |
| # modified by Evan Phoenix, Sept 2006 | |
| def sieve(m) | |
| flags = Flags.dup[0,m] | |
| count = 0 | |
| pmax = m - 1 | |
| p = 2 | |
| while p <= pmax | |
| unless flags[p].zero? | |
| count += 1 | |
| mult = p | |
| while mult <= pmax | |
| flags[mult] = 0 | |
| mult += p | |
| end | |
| end | |
| p += 1 | |
| end | |
| count | |
| end | |
| n = 9 # (ARGV[0] || 2).to_i | |
| Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*") | |
| n.downto(n-2) do |exponent| | |
| break if exponent < 0 | |
| m = (1 << exponent) * 10_000 | |
| # m = (2 ** exponent) * 10_000 | |
| count = sieve(m) | |
| printf "Primes up to %8d %8d\n", m, count | |
| end | |
| 2.6 1.6102409239992994 | |
| 2.6 1.62961931099926 | |
| 2.6 1.6875047169996833 | |
| 2.4 1.6272890630007169 | |
| 2.4 1.6216507210010604 | |
| 2.4 1.6279327199990803 | |
| 2.5 1.6880187799997657 | |
| 2.5 1.6573079589998088 | |
| 2.5 1.7321711929998855 | |
| mov 1.6718935949993465 | |
| mov 1.7367953619996115 | |
| mov 1.6812330209995707 | |
| ours 1.6406151089995546 | |
| ours 1.6313319809996756 | |
| ours 1.6581117320001795 | |
| ----------------------------------------------------------- | |
| so_nsieve_bits | |
| #!/usr/bin/ruby | |
| #coding: us-ascii | |
| # | |
| # The Great Computer Language Shootout | |
| # http://shootout.alioth.debian.org/ | |
| # | |
| # nsieve-bits in Ruby | |
| # Contributed by Glenn Parker, March 2005 | |
| CharExponent = 3 | |
| BitsPerChar = 1 << CharExponent | |
| LowMask = BitsPerChar - 1 | |
| def sieve(m) | |
| items = "\xFF" * ((m / BitsPerChar) + 1) | |
| masks = "" | |
| BitsPerChar.times do |b| | |
| masks << (1 << b).chr | |
| end | |
| count = 0 | |
| pmax = m - 1 | |
| 2.step(pmax, 1) do |p| | |
| if items[p >> CharExponent][p & LowMask] == 1 | |
| count += 1 | |
| p.step(pmax, p) do |mult| | |
| a = mult >> CharExponent | |
| b = mult & LowMask | |
| items[a] -= masks[b] if items[a][b] != 0 | |
| end | |
| end | |
| end | |
| count | |
| end | |
| n = 9 # (ARGV[0] || 2).to_i | |
| n.step(n - 2, -1) do |exponent| | |
| break if exponent < 0 | |
| m = 2 ** exponent * 10_000 | |
| count = sieve(m) | |
| printf "Primes up to %8d %8d\n", m, count | |
| end | |
| 2.6 2.2576205739987927 | |
| 2.6 2.2879901549986243 | |
| 2.6 2.2324862250006845 | |
| 2.4 2.340885702999003 | |
| 2.4 2.2873890030004986 | |
| 2.4 2.252403406000667 | |
| 2.5 2.239011956999093 | |
| 2.5 2.2241006290005316 | |
| 2.5 2.2675932780002768 | |
| mov 2.0689347650004493 | |
| mov 2.202370384999085 | |
| mov 2.124859891999222 | |
| ours 2.1029185770003096 | |
| ours 2.103586286000791 | |
| ours 2.085590255999705 | |
| ----------------------------------------------------------- | |
| so_object | |
| #!/usr/bin/ruby | |
| # -*- mode: ruby -*- | |
| # $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $ | |
| # http://www.bagley.org/~doug/shootout/ | |
| # with help from Aristarkh Zagorodnikov | |
| class Toggle | |
| def initialize(start_state) | |
| @bool = start_state | |
| end | |
| def value | |
| @bool | |
| end | |
| def activate | |
| @bool = !@bool | |
| self | |
| end | |
| end | |
| class NthToggle < Toggle | |
| def initialize(start_state, max_counter) | |
| super start_state | |
| @count_max = max_counter | |
| @counter = 0 | |
| end | |
| def activate | |
| @counter += 1 | |
| if @counter >= @count_max | |
| @bool = !@bool | |
| @counter = 0 | |
| end | |
| self | |
| end | |
| end | |
| n = 1500000 # (ARGV.shift || 1).to_i | |
| toggle = Toggle.new 1 | |
| 5.times do | |
| toggle.activate.value ? 'true' : 'false' | |
| end | |
| n.times do | |
| toggle = Toggle.new 1 | |
| end | |
| ntoggle = NthToggle.new 1, 3 | |
| 8.times do | |
| ntoggle.activate.value ? 'true' : 'false' | |
| end | |
| n.times do | |
| ntoggle = NthToggle.new 1, 3 | |
| end | |
| 2.6 0.7674058560005506 | |
| 2.6 0.7490566750002472 | |
| 2.6 0.6997501299993019 | |
| 2.4 0.7162041480005428 | |
| 2.4 0.7449557740001183 | |
| 2.4 0.6972389109996584 | |
| 2.5 0.7059759919993667 | |
| 2.5 0.7619405160003225 | |
| 2.5 0.7607218379998812 | |
| mov 0.6652307590011333 | |
| mov 0.6604044569994585 | |
| mov 0.6302140660009172 | |
| ours 0.6668127670000104 | |
| ours 0.644751064999582 | |
| ours 0.6704630240001279 | |
| ----------------------------------------------------------- | |
| so_partial_sums | |
| n = 2_500_000 # (ARGV.shift || 1).to_i | |
| alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0 | |
| 1.upto(n) do |d| | |
| d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d) | |
| s0 += (2.0 / 3.0) ** (d - 1.0) | |
| s1 += 1.0 / Math.sqrt(d) | |
| s2 += 1.0 / (d * (d + 1.0)) | |
| s3 += 1.0 / (d3 * ds * ds) | |
| s4 += 1.0 / (d3 * dc * dc) | |
| s5 += 1.0 / d | |
| s6 += 1.0 / d2 | |
| s7 += alt / d | |
| s8 += alt / (2.0 * d - 1.0) | |
| alt = -alt | |
| end | |
| if false | |
| printf("%.9f\t(2/3)^k\n", s0) | |
| printf("%.9f\tk^-0.5\n", s1) | |
| printf("%.9f\t1/k(k+1)\n", s2) | |
| printf("%.9f\tFlint Hills\n", s3) | |
| printf("%.9f\tCookson Hills\n", s4) | |
| printf("%.9f\tHarmonic\n", s5) | |
| printf("%.9f\tRiemann Zeta\n", s6) | |
| printf("%.9f\tAlternating Harmonic\n", s7) | |
| printf("%.9f\tGregory\n", s8) | |
| end | |
| 2.6 1.5522021589986252 | |
| 2.6 1.6133435200008535 | |
| 2.6 1.547386551001182 | |
| 2.4 1.801554756000769 | |
| 2.4 1.8172156929995253 | |
| 2.4 1.7894713940004294 | |
| 2.5 1.774220523000622 | |
| 2.5 1.7445383690010203 | |
| 2.5 1.7057036759997573 | |
| mov 1.5731607890011219 | |
| mov 1.5893576700000267 | |
| mov 1.502377434000664 | |
| ours 1.59014168000067 | |
| ours 1.638509640999473 | |
| ours 1.6738619050011039 | |
| ----------------------------------------------------------- | |
| so_pidigits | |
| # The Great Computer Language Shootout | |
| # http://shootout.alioth.debian.org/ | |
| # | |
| # contributed by Gabriele Renzi | |
| class PiDigitSpigot | |
| def initialize() | |
| @z = Transformation.new 1,0,0,1 | |
| @x = Transformation.new 0,0,0,0 | |
| @inverse = Transformation.new 0,0,0,0 | |
| end | |
| def next! | |
| @y = @z.extract(3) | |
| if safe? @y | |
| @z = produce(@y) | |
| @y | |
| else | |
| @z = consume @x.next!() | |
| next!() | |
| end | |
| end | |
| def safe?(digit) | |
| digit == @z.extract(4) | |
| end | |
| def produce(i) | |
| @inverse.qrst(10,-10*i,0,1).compose(@z) | |
| end | |
| def consume(a) | |
| @z.compose(a) | |
| end | |
| end | |
| class Transformation | |
| attr_reader :q, :r, :s, :t | |
| def initialize(q, r, s, t) | |
| @q,@r,@s,@t,@k = q,r,s,t,0 | |
| end | |
| def next!() | |
| @q = @k = @k + 1 | |
| @r = 4 * @k + 2 | |
| @s = 0 | |
| @t = 2 * @k + 1 | |
| self | |
| end | |
| def extract(j) | |
| (@q * j + @r) / (@s * j + @t) | |
| end | |
| def compose(a) | |
| self.class.new( @q * a.q, | |
| @q * a.r + r * a.t, | |
| @s * a.q + t * a.s, | |
| @s * a.r + t * a.t | |
| ) | |
| end | |
| def qrst *args | |
| initialize *args | |
| self | |
| end | |
| end | |
| WIDTH = 10 | |
| n = 2_500 # Integer(ARGV[0]) | |
| j = 0 | |
| digits = PiDigitSpigot.new | |
| while n > 0 | |
| if n >= WIDTH | |
| WIDTH.times {print digits.next!} | |
| j += WIDTH | |
| else | |
| n.times {print digits.next!} | |
| (WIDTH-n).times {print " "} | |
| j += n | |
| end | |
| puts "\t:"+j.to_s | |
| n -= WIDTH | |
| end | |
| 2.6 1.186393894999128 | |
| 2.6 1.1833510090000345 | |
| 2.6 1.1735205620007036 | |
| 2.4 1.1618239780000295 | |
| 2.4 1.1466504959989834 | |
| 2.4 1.128009963000295 | |
| 2.5 1.1182356299996172 | |
| 2.5 1.1632011250003416 | |
| 2.5 1.1362772940010473 | |
| mov 1.107688900001449 | |
| mov 1.1241363610006374 | |
| mov 1.1140436379992025 | |
| ours 1.128270461998909 | |
| ours 1.139118449000307 | |
| ours 1.1090284120000433 | |
| ----------------------------------------------------------- | |
| so_random | |
| # from http://www.bagley.org/~doug/shootout/bench/random/random.ruby | |
| IM = 139968.0 | |
| IA = 3877.0 | |
| IC = 29573.0 | |
| $last = 42.0 | |
| def gen_random(max) | |
| (max * ($last = ($last * IA + IC) % IM)) / IM | |
| end | |
| N = 3_000_000 | |
| i = 0 | |
| while i<N | |
| i +=1 | |
| gen_random(100.0) | |
| end | |
| # "%.9f" % gen_random(100.0) | |
| 2.6 0.317847222000637 | |
| 2.6 0.35848786200040195 | |
| 2.6 0.3278361130014673 | |
| 2.4 0.35831136900014826 | |
| 2.4 0.35687618399970233 | |
| 2.4 0.36264436899909924 | |
| 2.5 0.3426302219995705 | |
| 2.5 0.3488985969997884 | |
| 2.5 0.36366021300091234 | |
| mov 0.312154618999557 | |
| mov 0.3101769739987503 | |
| mov 0.3230691739991016 | |
| ours 0.323134416999892 | |
| ours 0.3306380240010185 | |
| ours 0.3320193810013734 | |
| ----------------------------------------------------------- | |
| so_reverse_complement | |
| #!/usr/bin/ruby | |
| # The Great Computer Language Shootout | |
| # http://shootout.alioth.debian.org/ | |
| # | |
| # Contributed by Peter Bjarke Olsen | |
| # Modified by Doug King | |
| seq=Array.new | |
| def revcomp(seq) | |
| seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN') | |
| stringlen=seq.length | |
| 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"} | |
| end | |
| input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb') | |
| while input.gets | |
| if $_ =~ />/ | |
| if seq.length != 0 | |
| revcomp(seq.join) | |
| seq=Array.new | |
| end | |
| puts $_ | |
| else | |
| $_.sub(/\n/,'') | |
| seq.push $_ | |
| end | |
| end | |
| revcomp(seq.join) | |
| 2.6 0.5489404689997173 | |
| 2.6 0.5404208580002887 | |
| 2.6 0.5462583740008995 | |
| 2.4 0.5680135959992185 | |
| 2.4 0.5497708099992451 | |
| 2.4 0.5395834880000621 | |
| 2.5 0.6021959359986795 | |
| 2.5 0.5516969010004686 | |
| 2.5 0.5328039040014119 | |
| mov 0.5196672190013487 | |
| mov 0.562355188998481 | |
| mov 0.5638176230004319 | |
| ours 0.5843735710004694 | |
| ours 0.5236466059996019 | |
| ours 0.5464601089988719 | |
| ----------------------------------------------------------- | |
| so_sieve | |
| # from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby | |
| num = 500 | |
| count = i = j = 0 | |
| flags0 = Array.new(8192,1) | |
| k = 0 | |
| while k < num | |
| k += 1 | |
| count = 0 | |
| flags = flags0.dup | |
| i = 2 | |
| while i<8192 | |
| i += 1 | |
| if flags[i] | |
| # remove all multiples of prime: i | |
| j = i*i | |
| while j < 8192 | |
| j += i | |
| flags[j] = nil | |
| end | |
| count += 1 | |
| end | |
| end | |
| end | |
| count | |
| 2.6 0.4842971360012598 | |
| 2.6 0.5040317860002688 | |
| 2.6 0.5510640459997376 | |
| 2.4 0.5387039269990055 | |
| 2.4 0.48529543000040576 | |
| 2.4 0.4990145820011094 | |
| 2.5 0.5582072289998905 | |
| 2.5 0.5150585970004613 | |
| 2.5 0.5386602559992753 | |
| mov 0.5062628030009364 | |
| mov 0.5450196470010269 | |
| mov 0.4803183030016953 | |
| ours 0.4742865630014421 | |
| ours 0.48345261299982667 | |
| ours 0.5337589640002989 | |
| ----------------------------------------------------------- | |
| so_spectralnorm | |
| # The Computer Language Shootout | |
| # http://shootout.alioth.debian.org/ | |
| # Contributed by Sokolov Yura | |
| def eval_A(i,j) | |
| return 1.0/((i+j)*(i+j+1)/2+i+1) | |
| end | |
| def eval_A_times_u(u) | |
| v, i = nil, nil | |
| (0..u.length-1).collect { |i| | |
| v = 0 | |
| for j in 0..u.length-1 | |
| v += eval_A(i,j)*u[j] | |
| end | |
| v | |
| } | |
| end | |
| def eval_At_times_u(u) | |
| v, i = nil, nil | |
| (0..u.length-1).collect{|i| | |
| v = 0 | |
| for j in 0..u.length-1 | |
| v += eval_A(j,i)*u[j] | |
| end | |
| v | |
| } | |
| end | |
| def eval_AtA_times_u(u) | |
| return eval_At_times_u(eval_A_times_u(u)) | |
| end | |
| n = 500 # ARGV[0].to_i | |
| u=[1]*n | |
| for i in 1..10 | |
| v=eval_AtA_times_u(u) | |
| u=eval_AtA_times_u(v) | |
| end | |
| vBv=0 | |
| vv=0 | |
| for i in 0..n-1 | |
| vBv += u[i]*v[i] | |
| vv += v[i]*v[i] | |
| end | |
| str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n" | |
| # print str | |
| 2.6 1.7904831409996405 | |
| 2.6 1.7761573030002182 | |
| 2.6 1.8563808070011873 | |
| 2.4 1.7850994399996125 | |
| 2.4 1.8125653629995213 | |
| 2.4 1.7561759210002492 | |
| 2.5 1.878547381998942 | |
| 2.5 1.9038954099996772 | |
| 2.5 1.8342162690005352 | |
| mov 1.6627514379997592 | |
| mov 1.6737254840008973 | |
| mov 1.6937658000006195 | |
| ours 1.8152416390003054 | |
| ours 1.841645762000553 | |
| ours 1.6931533690003562 | |
| ----------------------------------------------------------- | |
| raw data: | |
| [["so_ackermann", | |
| [[0.4554562140001508, 0.5460585769997124, 0.48677734000011696], | |
| [0.5426385809987551, 0.5000252749996434, 0.5233149949999643], | |
| [0.5049834759993246, 0.4907812910005305, 0.4685020809993148], | |
| [0.5007250029993884, 0.5030296860004455, 0.5188449830002355], | |
| [0.4566567390011187, 0.48271287699935783, 0.4353388810013712]]], | |
| ["so_array", | |
| [[1.001565152000694, 0.9968090410002333, 0.9579997450000519], | |
| [0.9520652720002545, 0.9347633369998221, 0.9071830599987152], | |
| [0.9791266880001785, 0.9549793690002844, 0.9539940169997863], | |
| [0.7793143929993676, 0.8528579640005773, 0.7667878169995674], | |
| [0.8373816940002143, 0.8716633730000467, 0.8410910629991122]]], | |
| ["so_binary_trees", | |
| [[5.580577554999763, 5.672877137998512, 5.681266890000188], | |
| [5.6974034150007355, 5.571260650000113, 5.640231679999488], | |
| [5.69990062999932, 5.733895809999012, 5.803898205000223], | |
| [5.811514707000242, 5.8644480610000755, 5.676164667998819], | |
| [5.331443604000015, 5.276973361000273, 5.304218047998802]]], | |
| ["so_concatenate", | |
| [[4.162689265000154, 4.050541177999548, 3.940061029001299], | |
| [3.8832351839992043, 4.06592698500026, 4.063692245999846], | |
| [3.967408909998994, 4.124347431999922, 4.109010133999618], | |
| [3.357697522000308, 3.426567314998465, 3.360884959000032], | |
| [3.5874504879993765, 3.4942243530003907, 3.564860012000281]]], | |
| ["so_count_words", | |
| [[0.2116428770004859, 0.1751734769986797, 0.16015411599983054], | |
| [0.18809206900004938, 0.1868481969995628, 0.18051345399908314], | |
| [0.15815120999832288, 0.15577895199930936, 0.16851444699932472], | |
| [0.19810375300039595, 0.18774900899916247, 0.17638365699895076], | |
| [0.15821733499979018, 0.15316619599980186, 0.15631227900121303]]], | |
| ["so_exception", | |
| [[0.2500917070010473, 0.2577815829990868, 0.2467453930003103], | |
| [0.2741440910012898, 0.3024373070002184, 0.2643489359998057], | |
| [0.27839342600054806, 0.2732393279984535, 0.29030586299995775], | |
| [0.25994120500035933, 0.2585156980003376, 0.2854875550001452], | |
| [0.23863023100057035, 0.233121231000041, 0.23833293300049263]]], | |
| ["so_fannkuch", | |
| [[1.0336100099993928, 1.0444943120000971, 1.034648062000997], | |
| [1.043466446999446, 1.0758836380009598, 1.0880409520013927], | |
| [1.0696021799994924, 1.1295678669994231, 1.0254586539995216], | |
| [1.067924678000054, 1.0172085699996387, 1.0360942509996676], | |
| [1.019557445000828, 1.056072645000313, 0.9758349160001671]]], | |
| ["so_fasta", | |
| [[1.5346465650000027, 1.5587319389996992, 1.5562305639996339], | |
| [1.4634280749996833, 1.5208723189989541, 1.5450861049994273], | |
| [1.5067925960011053, 1.5190188649994525, 1.5980066030006128], | |
| [1.470517698000549, 1.4239339609994204, 1.4360517959994468], | |
| [1.4852364859998488, 1.5562712290011405, 1.497141076000844]]], | |
| ["so_k_nucleotide", | |
| [[1.2793361570002162, 1.2651835870001378, 1.1648964539999724], | |
| [1.2761893210008566, 1.2424752150000131, 1.2707221489999938], | |
| [1.2316716850000375, 1.2456048450003436, 1.199178054001095], | |
| [1.1634166130006633, 1.0996732419989712, 1.146168231000047], | |
| [1.1135896050000156, 1.1313269679994846, 1.1500560799995583]]], | |
| ["so_lists", | |
| [[0.5218417550004233, 0.510902490999797, 0.47880745499969635], | |
| [0.4924291390016151, 0.5186816120003641, 0.48233753299973614], | |
| [0.44882155699997384, 0.45768725899870333, 0.4700806780001585], | |
| [0.506731552999554, 0.4655134580007143, 0.4916510860002745], | |
| [0.4514159390000714, 0.4717869590003829, 0.45853865900062374]]], | |
| ["so_mandelbrot", | |
| [[2.256111303999205, 2.2605629179997777, 2.241643777999343], | |
| [2.3938522539992846, 2.4874032780007838, 2.516099497999676], | |
| [2.473859124998853, 2.4914793590014597, 2.3492270719998487], | |
| [2.1200521369992202, 2.0968204119999427, 2.0987915380010236], | |
| [2.266777340999397, 2.2108405149992905, 2.2757371539992164]]], | |
| ["so_matrix", | |
| [[0.5646408560005511, 0.5596649750004872, 0.5343214719996467], | |
| [0.6103218059997744, 0.5513107269998727, 0.613436568999532], | |
| [0.5668281639991619, 0.5668770060001407, 0.5371557170001324], | |
| [0.4638839500003087, 0.5026085760000569, 0.5268650039997738], | |
| [0.5241673550008272, 0.4785625139993499, 0.5010744080009317]]], | |
| ["so_meteor_contest", | |
| [[3.3938102409993007, 3.2230731029994786, 3.3083832079992135], | |
| [3.333183630000349, 3.1936890039996797, 3.352127272999496], | |
| [3.157131161000507, 3.1907435260000057, 3.1984603669989156], | |
| [2.930067057999622, 3.004820023999855, 3.0456303139999363], | |
| [3.0097075300000142, 3.029121400999429, 2.9827036269998644]]], | |
| ["so_nbody", | |
| [[1.2550447880003048, 1.2584950679993199, 1.2902751980000176], | |
| [1.3688920330005203, 1.3770301200001995, 1.408765128999221], | |
| [1.3036340500002552, 1.3396144020007341, 1.2664047769994795], | |
| [1.188340609000079, 1.2322647380005947, 1.2222536250010307], | |
| [1.2926347680004255, 1.3014565510002285, 1.315888162000192]]], | |
| ["so_nested_loop", | |
| [[1.1500995039987174, 1.188764454000193, 1.149731467001402], | |
| [1.1660717530012334, 1.1208360170003289, 1.1860202200005006], | |
| [1.1673170880003454, 1.1572580709998874, 1.1291040689993679], | |
| [0.8745094159985456, 0.9048835060002602, 0.9134807700011152], | |
| [1.0407441609986563, 0.9862627140009863, 1.0047832319996814]]], | |
| ["so_nsieve", | |
| [[1.6102409239992994, 1.62961931099926, 1.6875047169996833], | |
| [1.6272890630007169, 1.6216507210010604, 1.6279327199990803], | |
| [1.6880187799997657, 1.6573079589998088, 1.7321711929998855], | |
| [1.6718935949993465, 1.7367953619996115, 1.6812330209995707], | |
| [1.6406151089995546, 1.6313319809996756, 1.6581117320001795]]], | |
| ["so_nsieve_bits", | |
| [[2.2576205739987927, 2.2879901549986243, 2.2324862250006845], | |
| [2.340885702999003, 2.2873890030004986, 2.252403406000667], | |
| [2.239011956999093, 2.2241006290005316, 2.2675932780002768], | |
| [2.0689347650004493, 2.202370384999085, 2.124859891999222], | |
| [2.1029185770003096, 2.103586286000791, 2.085590255999705]]], | |
| ["so_object", | |
| [[0.7674058560005506, 0.7490566750002472, 0.6997501299993019], | |
| [0.7162041480005428, 0.7449557740001183, 0.6972389109996584], | |
| [0.7059759919993667, 0.7619405160003225, 0.7607218379998812], | |
| [0.6652307590011333, 0.6604044569994585, 0.6302140660009172], | |
| [0.6668127670000104, 0.644751064999582, 0.6704630240001279]]], | |
| ["so_partial_sums", | |
| [[1.5522021589986252, 1.6133435200008535, 1.547386551001182], | |
| [1.801554756000769, 1.8172156929995253, 1.7894713940004294], | |
| [1.774220523000622, 1.7445383690010203, 1.7057036759997573], | |
| [1.5731607890011219, 1.5893576700000267, 1.502377434000664], | |
| [1.59014168000067, 1.638509640999473, 1.6738619050011039]]], | |
| ["so_pidigits", | |
| [[1.186393894999128, 1.1833510090000345, 1.1735205620007036], | |
| [1.1618239780000295, 1.1466504959989834, 1.128009963000295], | |
| [1.1182356299996172, 1.1632011250003416, 1.1362772940010473], | |
| [1.107688900001449, 1.1241363610006374, 1.1140436379992025], | |
| [1.128270461998909, 1.139118449000307, 1.1090284120000433]]], | |
| ["so_random", | |
| [[0.317847222000637, 0.35848786200040195, 0.3278361130014673], | |
| [0.35831136900014826, 0.35687618399970233, 0.36264436899909924], | |
| [0.3426302219995705, 0.3488985969997884, 0.36366021300091234], | |
| [0.312154618999557, 0.3101769739987503, 0.3230691739991016], | |
| [0.323134416999892, 0.3306380240010185, 0.3320193810013734]]], | |
| ["so_reverse_complement", | |
| [[0.5489404689997173, 0.5404208580002887, 0.5462583740008995], | |
| [0.5680135959992185, 0.5497708099992451, 0.5395834880000621], | |
| [0.6021959359986795, 0.5516969010004686, 0.5328039040014119], | |
| [0.5196672190013487, 0.562355188998481, 0.5638176230004319], | |
| [0.5843735710004694, 0.5236466059996019, 0.5464601089988719]]], | |
| ["so_sieve", | |
| [[0.4842971360012598, 0.5040317860002688, 0.5510640459997376], | |
| [0.5387039269990055, 0.48529543000040576, 0.4990145820011094], | |
| [0.5582072289998905, 0.5150585970004613, 0.5386602559992753], | |
| [0.5062628030009364, 0.5450196470010269, 0.4803183030016953], | |
| [0.4742865630014421, 0.48345261299982667, 0.5337589640002989]]], | |
| ["so_spectralnorm", | |
| [[1.7904831409996405, 1.7761573030002182, 1.8563808070011873], | |
| [1.7850994399996125, 1.8125653629995213, 1.7561759210002492], | |
| [1.878547381998942, 1.9038954099996772, 1.8342162690005352], | |
| [1.6627514379997592, 1.6737254840008973, 1.6937658000006195], | |
| [1.8152416390003054, 1.841645762000553, 1.6931533690003562]]]] | |
| Elapsed time: 516.706142 (sec) | |
| ----------------------------------------------------------- | |
| benchmark results: | |
| minimum results in each 3 measurements. | |
| Execution time (sec) | |
| name 2.6 2.4 2.5 mov ours | |
| so_ackermann 0.455 0.500 0.469 0.501 0.435 | |
| so_array 0.958 0.907 0.954 0.767 0.837 | |
| so_binary_trees 5.581 5.571 5.700 5.676 5.277 | |
| so_concatenate 3.940 3.883 3.967 3.358 3.494 | |
| so_count_words 0.160 0.181 0.156 0.176 0.153 | |
| so_exception 0.247 0.264 0.273 0.259 0.233 | |
| so_fannkuch 1.034 1.043 1.025 1.017 0.976 | |
| so_fasta 1.535 1.463 1.507 1.424 1.485 | |
| so_k_nucleotide 1.165 1.242 1.199 1.100 1.114 | |
| so_lists 0.479 0.482 0.449 0.466 0.451 | |
| so_mandelbrot 2.242 2.394 2.349 2.097 2.211 | |
| so_matrix 0.534 0.551 0.537 0.464 0.479 | |
| so_meteor_contest 3.223 3.194 3.157 2.930 2.983 | |
| so_nbody 1.255 1.369 1.266 1.188 1.293 | |
| so_nested_loop 1.150 1.121 1.129 0.875 0.986 | |
| so_nsieve 1.610 1.622 1.657 1.672 1.631 | |
| so_nsieve_bits 2.232 2.252 2.224 2.069 2.086 | |
| so_object 0.700 0.697 0.706 0.630 0.645 | |
| so_partial_sums 1.547 1.789 1.706 1.502 1.590 | |
| so_pidigits 1.174 1.128 1.118 1.108 1.109 | |
| so_random 0.318 0.357 0.343 0.310 0.323 | |
| so_reverse_complement 0.540 0.540 0.533 0.520 0.524 | |
| so_sieve 0.484 0.485 0.515 0.480 0.474 | |
| so_spectralnorm 1.776 1.756 1.834 1.663 1.693 | |
| Speedup ratio: compare with the result of `2.6' (greater is better) | |
| name 2.4 2.5 mov ours | |
| so_ackermann 0.911 0.972 0.910 1.046 | |
| so_array 1.056 1.004 1.249 1.144 | |
| so_binary_trees 1.002 0.979 0.983 1.058 | |
| so_concatenate 1.015 0.993 1.173 1.128 | |
| so_count_words 0.887 1.028 0.908 1.046 | |
| so_exception 0.933 0.903 0.954 1.058 | |
| so_fannkuch 0.991 1.008 1.016 1.059 | |
| so_fasta 1.049 1.018 1.078 1.033 | |
| so_k_nucleotide 0.938 0.971 1.059 1.046 | |
| so_lists 0.993 1.067 1.029 1.061 | |
| so_mandelbrot 0.936 0.954 1.069 1.014 | |
| so_matrix 0.969 0.995 1.152 1.117 | |
| so_meteor_contest 1.009 1.021 1.100 1.081 | |
| so_nbody 0.917 0.991 1.056 0.971 | |
| so_nested_loop 1.026 1.018 1.315 1.166 | |
| so_nsieve 0.993 0.972 0.963 0.987 | |
| so_nsieve_bits 0.991 1.004 1.079 1.070 | |
| so_object 1.004 0.991 1.110 1.085 | |
| so_partial_sums 0.865 0.907 1.030 0.973 | |
| so_pidigits 1.040 1.049 1.059 1.058 | |
| so_random 0.891 0.928 1.025 0.984 | |
| so_reverse_complement 1.002 1.014 1.040 1.032 | |
| so_sieve 0.998 0.940 1.008 1.021 | |
| so_spectralnorm 1.011 0.968 1.068 1.049 | |
| Log file: bmlog-20180125-225613.88896.tsv |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| From 32ef51da53321aab69be1fe9d760c1b6f132b999 Mon Sep 17 00:00:00 2001 | |
| From: "Urabe, Shyouhei" <shyouhei@ruby-lang.org> | |
| Date: Thu, 21 Dec 2017 13:56:40 +0900 | |
| Subject: [PATCH] move ADD_PC around to optimize PC manipluiations | |
| This commit introduces new attribute handles_flame and if that is | |
| _not_ the case, places ADD_PC right before INC_SP. This prevents | |
| unnecessary PC manipulations for most opt_* instructions and as a | |
| result, reduces the size of vm_exec_core from 27,184 bytes to | |
| 25,536 bytes. | |
| Signed-off-by: Urabe, Shyouhei <shyouhei@ruby-lang.org> | |
| --- | |
| insns.def | 3 +++ | |
| tool/ruby_vm/models/bare_instructions.rb | 13 ++++++++++--- | |
| tool/ruby_vm/views/_insn_entry.erb | 9 ++++++++- | |
| 3 files changed, 21 insertions(+), 4 deletions(-) | |
| diff --git a/insns.def b/insns.def | |
| index 8f43e55b8a..cad686fee6 100644 | |
| --- a/insns.def | |
| +++ b/insns.def | |
| @@ -680,6 +680,7 @@ defineclass | |
| (ID id, ISEQ class_iseq, rb_num_t flags) | |
| (VALUE cbase, VALUE super) | |
| (VALUE val) | |
| +// attr bool handles_frame = true; | |
| { | |
| VALUE klass = vm_find_or_create_class_by_id(id, flags, cbase, super); | |
| @@ -829,6 +830,7 @@ leave | |
| () | |
| (VALUE val) | |
| (VALUE val) | |
| +// attr bool handles_frame = true; | |
| { | |
| if (OPT_CHECKED_RUN) { | |
| const VALUE *const bp = vm_base_ptr(reg_cfp); | |
| @@ -1380,6 +1382,7 @@ opt_call_c_function | |
| (rb_insn_func_t funcptr) | |
| () | |
| () | |
| +// attr bool handles_frame = true; | |
| { | |
| reg_cfp = (funcptr)(ec, reg_cfp); | |
| diff --git a/tool/ruby_vm/models/bare_instructions.rb b/tool/ruby_vm/models/bare_instructions.rb | |
| index 16d5782e2f..5ed27520ea 100644 | |
| --- a/tool/ruby_vm/models/bare_instructions.rb | |
| +++ b/tool/ruby_vm/models/bare_instructions.rb | |
| @@ -33,6 +33,7 @@ def initialize opts = {} | |
| h[a.key] = a | |
| } | |
| @attrs_orig = @attrs.dup | |
| + predefine_attributes | |
| end | |
| def pretty_name | |
| @@ -109,8 +110,8 @@ def operands_info | |
| }.join | |
| end | |
| - def pushs_frame? | |
| - opes.any? {|o| /CALL_INFO/ =~ o[:type] } | |
| + def handles_frame? | |
| + /\b(false|0)\b/ !~ @attrs['handles_frame'].expr.expr | |
| end | |
| def inspect | |
| @@ -126,7 +127,13 @@ def generate_attribute k, t, v | |
| type: t, \ | |
| location: [], \ | |
| expr: v.to_s + ';' | |
| - return @attrs[k] = attr | |
| + return @attrs[k] ||= attr | |
| + end | |
| + | |
| + def predefine_attributes | |
| + generate_attribute 'sp_inc', 'rb_snum_t', rets.size - pops.size | |
| + generate_attribute 'handles_frame', 'bool', \ | |
| + opes.any? {|o| /CALL_INFO/ =~ o[:type] } | |
| end | |
| def typesplit a | |
| diff --git a/tool/ruby_vm/views/_insn_entry.erb b/tool/ruby_vm/views/_insn_entry.erb | |
| index cebca8b8d0..c0199c5463 100644 | |
| --- a/tool/ruby_vm/views/_insn_entry.erb | |
| +++ b/tool/ruby_vm/views/_insn_entry.erb | |
| @@ -9,6 +9,7 @@ | |
| /* insn <%= insn.pretty_name %> */ | |
| #define NAME_OF_CURRENT_INSN <%= insn.name %> | |
| +#define WIDTH_OF_CURRENT_INSN <%= insn.width %> | |
| INSN_ENTRY(<%= insn.name %>) | |
| { | |
| % unless insn.declarations.empty? | |
| @@ -28,8 +29,9 @@ INSN_ENTRY(<%= insn.name %>) | |
| <%= pop[:name] %> = <%= insn.cast_from_VALUE pop, "TOPN(#{i})"%>; | |
| % end | |
| DEBUG_ENTER_INSN(<%=cstr insn.name %>); | |
| +% if insn.handles_frame? | |
| ADD_PC(<%= insn.width %>); | |
| - PREFETCH(GET_PC()); | |
| +% end | |
| % unless insn.pops.empty? | |
| POPN(<%= insn.pops.size %>); | |
| % end | |
| @@ -38,6 +40,10 @@ INSN_ENTRY(<%= insn.name %>) | |
| COLLECT_USAGE_OPERAND(<%= insn.bin %>, <%= i %>, <%= ope[:name] %>); | |
| % end | |
| <%= render_c_expr insn.expr -%> | |
| +% unless insn.handles_frame? | |
| + ADD_PC(<%= insn.width %>); | |
| + PREFETCH(GET_PC()); | |
| +% end | |
| % unless insn.rets.empty? | |
| CHECK_VM_STACK_OVERFLOW_FOR_INSN(VM_REG_CFP, <%= insn.rets.size %>); | |
| % insn.rets.each_with_index do |ret, i| | |
| @@ -47,4 +53,5 @@ INSN_ENTRY(<%= insn.name %>) | |
| % | |
| END_INSN(<%= insn.name %>); | |
| } | |
| +#undef WIDTH_OF_CURRENT_INSN | |
| #undef NAME_OF_CURRENT_INSN | |
| -- | |
| 2.15.1 | |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
