Skip to content

Instantly share code, notes, and snippets.

@szeitlin
Created February 12, 2014 02:48
Show Gist options
  • Select an option

  • Save szeitlin/8949129 to your computer and use it in GitHub Desktop.

Select an option

Save szeitlin/8949129 to your computer and use it in GitHub Desktop.
Rosalind problem 1 solution.
#Rosalind problem 1
def ACGT_count(sequence):
'''
(str) -> (int, int, int, int)
Count the number of A, C, G and T in a string.
>>>ACGT_count('ATGCTTCAGAAAGGTCTTACG')
6 4 5 1
'''
A=0
C=0
G=0
T=0
for char in sequence:
if char == "A":
A = A + 1
elif char == 'C':
C = C + 1
elif char == 'G':
G = G + 1
elif char == 'T':
T = T + 1
else:
print('not a nucleotide')
print(A, C, G, T)
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment