Last active
April 19, 2023 16:06
-
-
Save tgs/3f1ebeae3adc29d760cbc19c37d2afe8 to your computer and use it in GitHub Desktop.
Translate NCBI2na data from hexadecimal to standard bases
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
""" | |
Translate compact hex sequence representation to standard bases. | |
If you have NCBI ASN.1 data, the easiest way to get a FASTA version is to | |
use NCBI's asn2fasta tool, which is available here: | |
https://ftp.ncbi.nlm.nih.gov/asn1-converters/by_program/asn2fasta/ | |
NCBI2na is a compact representation of sequence data, where each base just | |
takes 2 bits. It's commonly found in text ASN.1 files as hexadecimal strings. | |
In binary ASN.1, it is found as binary data - this script does not handle that. | |
In a string of hexadecimal digits, each digit represents two nucleotide bases. | |
And the hex string represents actual characters, so only even numbers of hex | |
digits are valid. So for any given hex string, there are four different | |
numbers of nucleotides it could represent. This means you need to provide the | |
length of the nucleotide sequence you expect. | |
>>> import ncbi2na | |
>>> ncbi2na.decode_ncbi2na(20, u'0123456789') | |
'AAACAGATCACCCGCTGAGC' | |
>>> ncbi2na.decode_ncbi2na(17, u'0123456789') | |
'AAACAGATCACCCGCTG' | |
Since we have the expected length, we can sanity-check it against the input | |
string: | |
>>> ncbi2na.decode_ncbi2na(16, u'0123456789') | |
Traceback (most recent call last): | |
... | |
ValueError: Found more nuc bases than expected | |
>>> ncbi2na.decode_ncbi2na(21, u'0123456789') | |
Traceback (most recent call last): | |
... | |
ValueError: Found fewer nuc bases than expected | |
This should work from Python 2 or 3, but the hexadecimal string | |
must be unicode because the `translate` method works very differently | |
in byte strings. | |
""" | |
from itertools import product | |
__all__ = ['decode_ncbi2na'] | |
_nucs = u'ACGT' | |
_replacements = list(map(u''.join, product(_nucs, _nucs))) | |
_hex2nuc = dict(zip(map(ord, u'0123456789ABCDEF'), _replacements)) | |
if bytes is str: # python2 | |
_text_type = unicode | |
else: | |
_text_type = str | |
def decode_ncbi2na(length, hex_str): | |
if not isinstance(hex_str, _text_type): | |
raise TypeError("hex_str must be unicode/text type") | |
seq_untrimmed = hex_str.translate(_hex2nuc) | |
raw_len = len(seq_untrimmed) | |
if length > raw_len: | |
raise ValueError("Found fewer nuc bases than expected") | |
if length < raw_len - 3: | |
raise ValueError("Found more nuc bases than expected") | |
return seq_untrimmed[:length] |
If you have ncbi2na data, it's likely to be in asn.1, right? My actual suggestion is to use asn2fasta from https://ftp.ncbi.nlm.nih.gov/asn1-converters/by_program/asn2fasta/
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
@MrTomRod - I've added support for setting the length of the nucleotide sequence, so that sequences can be extracted correctly. Thanks for asking, hope it helps - let me know if there are more issues