Skip to content

Instantly share code, notes, and snippets.

@tiptopcoder
Last active May 12, 2016 05:39
Show Gist options
  • Select an option

  • Save tiptopcoder/21163bc1b21c9ae5847e3995c4fb8617 to your computer and use it in GitHub Desktop.

Select an option

Save tiptopcoder/21163bc1b21c9ae5847e3995c4fb8617 to your computer and use it in GitHub Desktop.
Locating Restriction Sites Algorithm
# Locating Restriction Sites
# ==========================
#
# A DNA string is a reverse palindrome if it is equal to its reverse complement.
# For instance, GCATGC is a reverse palindrome because its reverse complement is GCATGC.
#
# Given: A DNA string of length at most 1 kbp.
#
# Return: The position and length of every reverse palindrome in the string having length between 4 and 12.
#
# ==========================
#
# Sample Dataset
# --------------
# TCAATGCATGCGGGTCTATATGCAT
#
# Sample Output
# -------------
# 4 6
# 5 4
# 6 6
# 7 4
# 17 4
# 18 4
# 20 6
# 21 4
# ==========================
from Bio import SeqIO
def reverse_complement(s):
complements = {'A':'T', 'T':'A', 'G':'C', 'C':'G'}
return ''.join([complements[c] for c in reversed(s)])
def reverse_palindromes(s):
results = []
l = len(s)
for i in range(l): #looping over string s
for j in range(4, 12): #palindrome length from 4 to 12
if i + j > l: #prevent string s out of range
continue
s1 = s[i:i+j]
s2 = reverse_complement(s1)
if s1 == s2:
results.append((i + 1, j))
return results
handle = open("fasta.fasta", "rU")
for record in SeqIO.parse(handle,"fasta"):
DNA = str(record.seq)
results = reverse_palindromes(DNA)
print "\n".join([' '.join(map(str, r)) for r in results])
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment