This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Sample_python_native_apps_script.py:2:15: W291 trailing whitespace | |
| Sample_python_native_apps_script.py:6:1: E302 expected 2 blank lines, found 1 | |
| Sample_python_native_apps_script.py:8:1: E122 continuation line missing indentation or outdented | |
| Sample_python_native_apps_script.py:17:1: W293 blank line contains whitespace | |
| Sample_python_native_apps_script.py:18:1: E101 indentation contains mixed spaces and tabs | |
| Sample_python_native_apps_script.py:18:1: W191 indentation contains tabs | |
| Sample_python_native_apps_script.py:19:1: E101 indentation contains mixed spaces and tabs | |
| Sample_python_native_apps_script.py:25:1: E265 block comment should start with '# ' | |
| Sample_python_native_apps_script.py:31:29: E201 whitespace after '(' | |
| Sample_python_native_apps_script.py:38:1: E112 expected an indented block |
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >gi|459567|dbj|D28543.1|HPCNS5PC Hepatitis C virus gene for NS5 protein, partial cds, isolate: B4/92 | |
| GAGCACGACATCTACCAATGTTGCCAACTGAACCCAGAGGCCAAGAAAGCCATAACATCCTTGACAGAGA | |
| GGCTTTACCTTGGTGGTCCCATGTTTAACTCGCGAGGTCAGCTCTGCGGGACACGCAGATGCCGGGCGAG | |
| CGGGGTTCTTCCAACCAGCATGGGCAATACCCTCACATGTTACCTGAAAGCACAGGCAGCTTGCCGTGCA | |
| GCAGGCCTCACCAATTCTGACATGTTGGTTTGCGGAGATGATTTGGTAGTCATCACTGAGAGTGCCGGAG | |
| TC | |
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| worker_processes 2; | |
| error_log /tmp/error.log; | |
| pid /tmp/nginx.pid; | |
| events { | |
| worker_connections 1024; | |
| } | |
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| // | |
| // main.m | |
| // badonkas | |
| // | |
| // Created by Yoshiki Vázquez Baeza on 21/07/13. | |
| // Copyright (c) 2013 Yoshiki Vázquez Baeza. All rights reserved. | |
| // | |
| // Based on the source code as written by Norio Nomura for the project | |
| // usernotification https://github.com/norio-nomura/usernotification | |
| // gcc -framework Foundation main.m |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <!DOCTYPE html> | |
| <html> | |
| <head> | |
| <meta charset="utf-8" /> | |
| <title>test-3</title> | |
| <script src="https://cdnjs.cloudflare.com/ajax/libs/require.js/2.1.10/require.min.js"></script> | |
| <script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/2.0.3/jquery.min.js"></script> |
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.