Bede Constantinides bede
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >EDGE_1_length_179_cov_1.64557; | |
| TAGCATTTTAATATTATACATAACATGGTATAATATTAGATGTGTAATATAAAATCTAAA | |
| GCAACTACTACAAAAACAATACTAGAAGTTATGGCTACTAAGCCAACAAAGGATAAAAAA | |
| TAGAATCAAAATTAATTAATCCAAAAGAAGGAAGTAAAAGGGAACAAAGAATAGGTGGG | |
| >EDGE_1_length_179_cov_1.64557'; | |
| CCCACCTATTCTTTGTTCCCTTTTACTTCCTTCTTTTGGATTAATTAATTTTGATTCTAT | |
| TTTTTATCCTTTGTTGGCTTAGTAGCCATAACTTCTAGTATTGTTTTTGTAGTAGTTGCT | |
| TTAGATTTTATATTACACATCTAATATTATACCATGTTATGTATAATATTAAAATGCTA | |
| >EDGE_2_length_255_cov_1.11111; | |
| GAAAAACTCATTCTATGAGTGAATACACTTGGCAAGAAGTAGTGGGGCTGTAATTGTGAT |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| var tracks = [ | |
| { | |
| trackName: "track1", | |
| trackType: "track", | |
| visible: true, | |
| trackFeatures: "complex", | |
| featureThreshold: 1000, | |
| mouseover_callback: 'islandPopup', | |
| mouseout_callback: 'islandPopupClear', | |
| linear_mouseclick: 'linearPopup', |
bede
/ ebi_parallel_blast.ipynb
Last active
November 2, 2015 12:42
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
bede
/ python_basic_calculations.ipynb
Created
November 3, 2015 14:31
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| l-umobcdja2:homebrew-science Bede$ brew audit spades | |
| homebrew/science/spades: | |
| * Non-executables were installed to "/usr/local/Cellar/spades/3.6.2/bin" | |
| The offending files are: | |
| /usr/local/Cellar/spades/3.6.2/bin/spades_init.pyc | |
| Error: 1 problem in 1 formula | |
| l-umobcdja2:homebrew-science Bede$ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| class Spades < Formula | |
| desc "SPAdes: de novo genome assembly" | |
| homepage "http://bioinf.spbau.ru/spades/" | |
| # tag "bioinformatics" | |
| # doi "10.1089/cmb.2012.0021" | |
| url "http://spades.bioinf.spbau.ru/release3.6.2/SPAdes-3.6.2.tar.gz" | |
| sha256 "20897e2707623ee1033d3c88fefc42771fa4bbaafaf0f95642991d83b361eb5f" |
bede
/ plotly-streaming-example.ipynb
Last active
February 4, 2016 14:40
Plotly Streaming API example
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
bede
/ onecodex_real-time_k-mer_search_api.ipynb
Last active
February 11, 2016 11:04
OneCodex real-time search API
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
bede
/ Build failure on OS X 10.10.5
Created
March 12, 2016 18:16
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| After replacing /usr/bin/gcc and /usr/bin/g++ with symlinks to GCC 5.3 binaries... | |
| l-umobcdja2:freebayes Bede$ make | |
| wget -q http://hypervolu.me/freebayes/build/v1.0.2-6-g3ce827d & | |
| cd src && /Applications/Xcode.app/Contents/Developer/usr/bin/make | |
| DETECTED_VERSION = v1.0.2-6-g3ce827d-dirty | |
| CURRENT_VERSION = v1.0.2-6-g3ce827d | |
| Updating version file. | |
| cd ../bamtools && mkdir -p build && cd build && cmake .. && /Applications/Xcode.app/Contents/Developer/usr/bin/make | |
| -- Configuring done |