| Key | Definition |
|---|---|
| SAMPLE | Sample name |
| TYPE | Variant Type: SNV Insertion Deletion Complex |
| DP | Total depth |
| End | Chromosome end position |
| VD | Variant depth |
| AF | Allele frequency |
We can make this file beautiful and searchable if this error is corrected: It looks like row 4 should actually have 10 columns, instead of 1 in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Name,Slack Call Sign,Location,Interests,Skills (General),Preferred Language,Programming Languages,Education Background,Github Username,Preferred group within collab | |
| Mark van der Sman,mvdsman,"Leiden, The Netherlands","Visualisation, genomics, pattern recognition/ML, statistical analysis, phylogenetics/evolution (and many more)","Visualisation, genomics, web development, some transcriptomics and some Machine Learning/Natural Computing. Biologist going for MSc BI",R,"Most experienced in R/RShiny, decent in Python and HTML/CSS/Markdown, basics in C++, PHP, SQL. Flaming hatred towards Matlab","B.Sc. Biology + minor Data Science, going for M.Sc. Bioinformatics",MvdSman,Visualisation | |
| Anthony Fejes,apfejes,"Bay Area, California","Visualization, transcriptomics, epigenomics, genomics,","Biologist, biochemist, programmer, entrepreneur",Python,"Python, C, SQL/No-SQL, Java, etc. (Anything except R, Javascript)","B.Sc. Biochemitry | |
| B.I.S. | |
| M.Sc. Microbiology and Immunology | |
| PhD. Bioinformatics",apfejes, | |
| Dimitrios - Georgios |
I hereby claim:
- I am clintval on github.
- I am clintval (https://keybase.io/clintval) on keybase.
- I have a public key ASA1U0QRFP5NAtESP-6ztuMfcyXE23LNCGe9r7Vlb71nRgo
To claim this, I am signing this object:
QC Illumina flowcell, demultiplex, and QC mapped BAM
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| from collections import defaultdict | |
| import matplotlib.pyplot as plt | |
| import numpy as np | |
| import vcf | |
| from palettable.colorbrewer.qualitative import Paired_12 | |
| from scipy.stats import gaussian_kde | |
| from vcf_figures.helpers import * |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| package com.clintval.misc | |
| trait CommandLineTool { | |
| val Executable: String | |
| def exec(args: String*): ProcessBuilder = { new ProcessBuilder(Executable +: args: _*) } | |
| } | |
| trait Testable { | |
| self: CommandLineTool => | |
| val TestCommand: Seq[String] |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| /** Implicit methods for [[Template]] objects. */ | |
| implicit class TemplateUtil(val t: Template) { | |
| private def tagValue[A](records: Iterator[SamRecord], tag: String): Iterator[Option[A]] = records.map(_.get[A](tag)) | |
| def bestEditDistanceToReference(t: Template): Option[Int] = tagValue[Int](t.allReads, SAMTag.NM.name).min | |
| def worstEditDistanceToReference(t: Template): Option[Int] = tagValue[Int](t.allReads, SAMTag.NM.name).max | |
| def bestAlignmentScore(t: Template): Option[Int] = tagValue[Int](t.allReads, SAMTag.AS.name).max | |
| def worstAlignmentScore(t: Template): Option[Int] = tagValue[Int](t.allReads, SAMTag.AS.name).min | |
| } |
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| from types import MethodType | |
| class TypeSafeAttribute(object): | |
| def _type_of(self, attr): | |
| if not self._has_attr(attr): | |
| raise ValueError(f'No attribute defined as annotation: {attr}') | |
| return self.__annotations__[attr] | |
| def _has_attr(self, attr): |
Note: Build 37 coordinates.
TCGA-AB-2812 13 28608256 28608257 - TCATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAG
TCGA-AB-2825 13 28608217 28608218 - CCAAACTCTAAATTTTCTCTTGGAAACTCCCATTTGAGATCATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTATTCGTG
TCGA-AB-2830 13 28608242 28608243 - ACTCCCATTTGAGATCATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTACCCCCTCGGGGGG
TCGA-AB-2836 13 28608267 28608268 - TTCTCTGAAATCAACGTAGAAGTACTCATTATC
TCGA-AB-2840 13 28608248 28608249 - ATTTGAGATCATATTCAT
TCGA-AB-2844 13 28608214 28608215 - TTACCAAACTCTAAATTTTCTCTTGGAAACTCCCATTTGAGATCATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCT
TCGA-AB-2853 13 28608268 28608269 - TCTCTGAAATCAACGTAG