This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/bin/bash | |
# | |
#$ -j y | |
# join std out & err | |
#$ -cwd | |
# run job and store logs in cwd | |
#$ -m ea | |
# send mail on begin, end, & abort | |
#$ -M [email protected] # email address | |
#$ -N clark_tooloff # job name |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/bin/bash | |
#SBATCH -N 1 | |
#SBATCH -p RM | |
#SBATCH --ntasks-per-node 28 | |
EXC=/path/to/metaspades.py | |
R1=$1 | |
R2=$2 | |
O=$3 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
============================== index_reads ============================== | |
1 chunks to run. Starting... | |
<omitted...> | |
Traceback (most recent call last): | |
File "/home/dcd3001/.miniconda2/bin/athena-meta", line 11, in <module> | |
load_entry_point('athena==0.1', 'console_scripts', 'athena-meta')() | |
File "build/bdist.linux-x86_64/egg/main.py", line 102, in main | |
File "build/bdist.linux-x86_64/egg/main.py", line 36, in run |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"input_fqs":"/scratchLocal/cmlab/dcd3001/barcoded_only.fastq", | |
"ctgfasta_path":"/scratchLocal/cmlab/dcd3001/athena/barcoded_metaspades/contigs.fasta", | |
"reads_ctg_bam_path":"/scratchLocal/cmlab/dcd3001/athena/align-reads.spades-contigs.bam", | |
"cluster_settings": { | |
"cluster_type": "multiprocessing", | |
"processes": 8 | |
} | |
} |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
2017-06-14 09:44:45 - - 400 downsampled barcodes | |
2017-06-14 09:44:45 - - 5.475x estimated local coverage | |
2017-06-14 09:44:45 - - 2 min_support required | |
2017-06-14 09:44:46 - root-ctg:NODE_40_length_125948_cov_163.495;numreads:239831;checks:10;trunc-checks:False;asms:5;trunc-asms:False | |
2017-06-14 09:44:46 - - found 7 candidates | |
2017-06-14 09:44:46 - performing local assemblies | |
2017-06-14 09:44:46 - assembling with neighbor NODE_114_length_56824_cov_153.263 | |
2017-06-14 09:44:46 - - 7551 orig barcodes | |
2017-06-14 09:44:46 - - 400 downsampled barcodes | |
2017-06-14 09:44:46 - - 14.6305232749x estimated local coverage |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
D00547:847:HYHNTBCXX:2:2210:13659:82197 99 NODE_1_length_1110436_cov_187.551 1 60 13S114M = 196 345 AACGCCCGATGCGGTGCATCGGGCGTTTTGAGACTGAAACAGGTGTAAACCTATTTCAGGACTAGACATAACGCGTCAGTACTGGTTAGGTTCCATCTCCAGGTCAACCTTGAAGCGTTCAGCAATG IIIIIIIIIIIIIGIIIIIIIGIIIGIGIIIIIIIIIIIIIIGGIIGIGGGGGIGIGIIIGIIGGGIIGIIGIIIIIGGGGIIIIIIIIIGGGIIGIIIGGIIGIIIIIIIIGGIIIIIIGGGGGGG NM:i:0 MD:Z:114 AS:i:114 XS:i:68 BX:Z:GGCCGATGTTTGTTGG-1 | |
D00547:847:HYHNTBCXX:1:1202:8878:17523 99 NODE_1_length_1110436_cov_187.551 1 60 15S112M = 164 313 AAAACGCCCGATGCGGTGCATCGGGCGTTTTGAGACTGAAACAGGTGTAAACCTATTTCAGGACTAGACATAACGCGTCAGTACTGGTTAGGTTCCATCTCCAGGTCAACCTTGAAGCGTTCAGCAA GGIGIIGIG.GGIIIGAGGGGGG.GGGAGGGGGAGGGIIIIGGIAGGGGGGIIAGGGGGGGGGIIIIGIIIIGGGIGGGGGGGGIGGIGIIGGGGGIIGGGIGGGIGGGIGGGGGAAGGGGGG |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
from mongoengine.errors import ValidationError | |
from app.query_results.query_result_models import QueryResultMeta | |
from app.response import Response | |
class ResultModule: | |
def name(self): | |
raise NotImplementedError() |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
ssh-rsa AAAAB3NzaC1yc2EAAAADAQABAAACAQDLJ10rLNtZhKRxivkYCHHi+UXVDwizALoF/YWDHrxtAKcHTkZgq+MxX5Z0gJOEgFkqUTPXehvyNInIqLHT42So1srWevLoftE7tTqftWuI7IrStc6mygIVpDBkkQsX31gbomRo0T59PAosBw82cPgKP1FBac1WPgOhFGVguFev4l8A5wdXLy9luw+kwMvzO5h2quxL8+NkPwVOWarP3AqLCeW10c5uTRec/Z/vdMHM57oCo9iAeGR8lD6PBE5OKN1f6iSmCOC0E8UegAVIoM2SgAhZBmgrNXDyeXsk7ss+Ud9QYuBZSvagAGHI9dtznED9v5LkEZQ40ZbdLXjmvqBzADScI+im8kDTgdYc+UDSay+11O9itA3zOahcPuE9THEYGai9wzVc2JXdykPp0l2ikMptefozQL6GGkYBOyyBb6yPdxzD5qLl/Kg8ubxE3dwlzFb+J2o067dqsfvhXqjLcnLC8sDkVUN+Ssx+ps4Pr5zShXmm2Y7516BiiUVWTBT6XL956mqy6j81IU+lxm896RCsCosx4rJ8f1VgCLWgNyKCz2/6W+epKC79MGe8w0wc5w9xiL02G6K+Z+GtygP9YcWpMOATDwbIAkFOiweXEtrILbsTTDEMnBVzd9R/A4ZPleYFyK9WFAQqZ1DBfIxgQgnzqMxI+62W3U9tt5zwhw== [email protected] |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import click | |
def parse_fasta(fasta): | |
cur_line, cur_header = '', '' | |
for line in fasta: | |
line = line.strip().upper() | |
if line[0] == '>': | |
if cur_line: | |
click.echo(cur_header, err=True) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
BC-0332760505 | BC-0332766367 | BC-0332766553 | ||
---|---|---|---|---|
gzip | 7.2G | 6.8G | 2.1G | |
bzip2 | 3.6G | 3.3G | 1.4G | |
BAM | 6.2G | 5.9G | 1.9G | |
blocked gzip | 5.1G | 4.8G | 1.6G | |
blocked bzip2 | 3.3G | 3.0G | 1.3G | |
blocked gzip (no q-scores) | 4.0G | 3.8G | 1.3G |
OlderNewer