rdmpage’s gists

rdmpage / query.txt

Created May 19, 2016 10:08

Querying Wikipedia for links to BioStor

	The Mediawiki API can be used to find qhat wikipedia pages link to BioStor, e.g.:

	https://en.wikipedia.org/w/api.php?action=query&list=exturlusage&euquery=biostor.org&eulimit=20

	See https://www.mediawiki.org/wiki/API:Lists/All#Exturlusage for details.

rdmpage / Cricula.nexus

Created May 10, 2016 13:27

Cricula NEXUS

	#NEXUS

	Begin trees; [Treefile saved Thu Aug 20 21:42:14 2015]
	[!
	>Data file = /Users/rpage/Sites/geojson-phylogeny-demo/bold-api/service/tmp/SAUPA642-10/SAUPA642-10.nex
	>Neighbor-joining search settings:
	> Ties (if encountered) will be broken systematically
	> Distance measure = uncorrected ("p")
	> (Tree is unrooted)
	]

rdmpage / Cricula.geojson

Last active May 10, 2016 13:27

Cricula barcode map

Sorry, something went wrong. Reload?

Sorry, we cannot display this file.

Sorry, this file is invalid so it cannot be displayed.

rdmpage / primers.txt

Last active May 17, 2018 10:10

COI DNA barcode primer locations

	Reference COI is NC_003128 Buteo buteo COI

	TZBRD035-15.COI-5P [648bp] ctgatctttggtgnatgagcaggcatagccggcacagcacttagcctactaatccgcgcagaactaggacagccaggaacactattgggagacgaccaaatctacaatgtaatcgtaacagcccacgctttcgtcataatcttcttcatagtcatacctattatgatcggaggcttcggaaactgactggttccactcataattggcgccccagacatagcattcccccgcataaataatatgagcttctgactcctcccaccttcttttctcctcctactagcctcctctacagtagaagccggggctggcactggatgaactgtttatccacccctagccggtaatcttgcccacgcgggcgcatcagtagacctggctattttttcccttcacttggcaggcgtgtcgtccatcttaggagctattaactttatcaccacaattattaacataaagccccctgcactatcacaatatcaaacacccctcttcgtatgatccgtcctcattactgctatcctcttactactatccctgccagtcctagccgccgggattacaatactcctcaccgatcgcaacctcaacactacattctttgaccctgcaggaggaggagacccaatcctgtatcaacacctattc
	TZBRD019-15.COI-5P tcttcggcgcctgagctggtatagtcggcaccgccctcagcttactcatccgtgcagaactcggccaacccggcacactcctaggtgacgaccaaatttataacgtaatcgttaccgcacatgccttcgtaataatcttcttcatagttataccaatcatgatcggaggattcggaaactgacttgttccactcataattggcgctc

rdmpage / index.html

Last active April 20, 2016 21:46

Query GBIF by drawing on map

	<!DOCTYPE html>
	<html>
	<head>
	<title>GBIF search</title>
	<meta charset="utf-8" />
	<link
	rel="stylesheet"
	href="http://cdn.leafletjs.com/leaflet-0.7/leaflet.css"
	/>
	<link

rdmpage / geojson-conversion.sh

Created January 11, 2016 13:15 — forked from benbalter/geojson-conversion.sh

Bulk convert shapefiles to geojson using ogr2ogr

	# Bulk convert shapefiles to geojson using ogr2ogr
	# For more information, see http://ben.balter.com/2013/06/26/how-to-convert-shapefiles-to-geojson-for-use-on-github/

	# Note: Assumes you're in a folder with one or more zip files containing shape files
	# and Outputs as geojson with the crs:84 SRS (for use on GitHub or elsewhere)

	#geojson conversion
	function shp2geojson() {
	ogr2ogr -f GeoJSON -t_srs crs:84 "$1.geojson" "$1.shp"
	}

rdmpage / collection.json

Created December 10, 2015 06:02

EOL Collections Write API

{"collection":{"name":"Mesoplodon","description":"Mesoplodon species","collection_items":[{"collected_item_type":"TaxonConcept","collected_item_id":328563}]}}

rdmpage / jbig2enc-master.txt

Created October 21, 2015 20:29

Compiling leptonica-1.68 and jbig2enc

	Need to supply paths to configure

	./configure CPPFLAGS=-I/usr/local/include LDFLAGS=-L/usr/local/lib

rdmpage / curl.txt

Created October 5, 2015 13:26

Get URLs/PDFs over slow connections (e.g., China)

curl -L -C - '<url>'

rdmpage / Merge PDFs.txt

Created September 8, 2015 21:24

Merge PDFs in a directory into one PDF using ghostscript, without rotating pages

gs -q -dNOPAUSE -dBATCH -dAutoRotatePages=/None -sDEVICE=pdfwrite -sOutputFile=merged.pdf *.pdf

Roderic Page rdmpage