- Install JAVA 8
brew install adoptopenjdk8
- Install Nextflow:
curl https://get.nextflow.io | bashin the current directory Optional: Move the nextflow binary to a directory that is in thePATH.
| library(tidyverse) | |
| # Get Gene Summary info | |
| gs_orig <- read_tsv("https://ftp.ncbi.nlm.nih.gov/gene/DATA/gene_summary.gz") | |
| gs <- gs_orig |> | |
| janitor::clean_names() |> | |
| set_names(str_replace, "number_tax_id", "tax_id") |> | |
| filter(tax_id==9606) |> | |
| distinct() | |
| gs |
| from dnachisel import * | |
| # Subbed in `CCTCCT` for `AAAGTT` to account for proline substitution | |
| virus = 'ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCAC |
05/22 - Deep Learning Hands-On Series - Data Exploration and API First Design 🎥
05/29 - Deep Learning Hands-On Series - Model Tuning 🎥
06/05 - Deep Learning Hands-On Series - Monitoring [cancelled]
| RUNS, = glob_wildcards("fastq/{run}_1.fastq.gz") | |
| SALMON = "/proj/milovelab/bin/salmon-1.4.0_linux_x86_64/bin/salmon" | |
| ANNO = "/proj/milovelab/anno" | |
| rule all: | |
| input: expand("quants/{run}/quant.sf", run=RUNS) | |
| rule salmon_index: |
| # Copyright 2019 Hannes Bretschneider | |
| # | |
| # Permission is hereby granted, free of charge, to any person | |
| # obtaining a copy of this software and associated documentation | |
| # files (the "Software"), to deal in the Software without | |
| # restriction, including without limitation the rights to use, | |
| # copy, modify, merge, publish, distribute, sublicense, and/or sell | |
| # copies of the Software, and to permit persons to whom the | |
| # Software is furnished to do so, subject to the following | |
| # conditions: |
| #!/bin/bash | |
| # Based on https://github.com/sylabs/singularity/issues/1537 | |
| # Usage: bash docker2singularity.sh mydockerimg mysingularity.simg | |
| set -ueo pipefail | |
| IMG=$1 | |
| FILEOUT=$2 | |
| PORT=${3:-5000} |
| ## requirement bed tools | |
| BIN='/home/hirak/bedtools2/bin' | |
| ## Gencode | |
| ## gencode.v29.chr_patch_hapl_scaff.annotation.gtf | |
| GTF_FILE="gencode.v29.chr_patch_hapl_scaff.annotation.gtf" | |
| # extract transcript boundaries | |
| cat $GTF_FILE | awk 'BEGIN{OFS="\t";} $3=="transcript" {print $1,$4-1,$5,$12}' | tr -d "\"" | tr -d ";" | $BIN/sortBed > gencode_transcript_intervals.bed | |
| # merge exon boundaris |
| snippet module | |
| ${1:name}UI <- function(id){ | |
| ns <- NS(id) | |
| tagList( | |
| ) | |
| } | |
| ${1:name} <- function(input, output, session){ | |
| library(tidyverse) | |
| library(rio) | |
| library(rvest) | |
| library(janitor) | |
| # Rcode to go and fetch country codes | |
| country_codes <- read_html("http://web.stanford.edu/~chadj/countrycodes6.3") %>% | |
| html_text() %>% | |
| str_extract_all("[A-Z]{3}") %>% |