Matt Shirley mdshw5
mdshw5
/ Autocorrelation of CpGs.ipynb
Last active
August 29, 2015 14:19
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
mdshw5
/ report.xml
Created
February 3, 2015 17:54
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <Test-sra> | |
| <Version> | |
| NCBI SRA Toolkit release version: 2.4.3.<br/> | |
| Latest available NCBI SRA Toolkit release version: 2.4.3.<br/> | |
| You already have the latest version of SRA Toolkit. | |
| </Version> | |
| <Os>Darwin LT-SHIRLEYM.local 14.1.0 Darwin Kernel Version 14.1.0: Mon Dec 22 23:10:38 PST 2014; root:xnu-2782.10.72~2/RELEASE_X86_64 x86_64</Os> | |
| <Ascp> | |
| ascp_locate = RC(rcNS,rcFile,rcCopying,rcFile,rcNotFound) | |
| <MaxRate>300m</MaxRate> |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| curl -s ftp://ftp.ncbi.nlm.nih.gov//genbank/genomes/Eukaryotes/vertebrates_mammals/Homo_sapiens/GRCh38/seqs_for_alignment_pipelines/GCA_000001405.15_GRCh38_full_analysis_set.fna.gz \ | |
| | gunzip | grep '[WK]' |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >c1042 | |
| ACCGTACCC | |
| >c1043 | |
| GCTACAGTTGAAAGGGGACCGTACCC | |
| >c1044 | |
| ATGAATAAAATAATTTTGTATCATAAATCGAGCTGTTAATTATT | |
| >c1045 | |
| TTCATATTTGTAGCTAAGCAGAGGCGAAGCGTTCTTGTATCG |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| from pyfaidx import Fasta | |
| ids = [1, 5, 10] | |
| multifasta = Fasta('multifasta.fa') | |
| records = [multifasta[i] for i in ids] | |
| for record in records: | |
| # do something with the fasta entries such as... | |
| print(record.seq) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/sh | |
| colname=${1}"\t"; | |
| colval=${2}"\t"; | |
| awk -v colname="$colname" -v colval="$colval" '{ if ($1 == "threshold") { printf(colname); print } else { printf(colval); print }}' "$3" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| import sys | |
| import numpy | |
| def main(): | |
| script=sys.argv[0] | |
| action=sys.argv[1] | |
| filenames=sys.argv[2:] | |
| assert action in ['--min", '--mean','--max'],\ | |
| Action is not one of --min, --mean, or --max: ' + action |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| %% mean_of_list_of_ints(%%): | |
| assert isinstance(%%, l) | |
| assert all([type(n) is %% for n in l]) | |
| length = len(l) | |
| mean = sum(l) / length | |
| %% mean | |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| def get_alignment(line): | |
| col = line.split('\t') | |
| if sam_format: | |
| if line[0] == '@': return [] | |
| flag = col[1] | |
| if 'u' in flag: return [] | |
| if options.unique and 's' in flag: return [] | |
| if options.pair and 'P' not in flag: return [] |
mdshw5
/ freec2bedgraph.py
Last active
August 29, 2015 14:05
convert FREEC ratio.txt file to bedGraph format
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| """ | |
| Chromosome Start Ratio MedianRatio CopyNumber | |
| 1 1 -1 -1 5 | |
| 1 9854 4.28786 2.74942 5 | |
| 1 19707 3.38082 2.74942 5 | |
| 1 29560 2.56094 2.74942 5 | |
| 1 39413 2.87198 2.74942 5 | |
| 1 49266 2.47 2.74942 5 | |
| 1 59119 2.62686 2.74942 5 | |
| 1 68972 2.0109 1.81246 4 |